Clone Read LE_HBa0230N09_T7_405847

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0230N09_T7_405847
Primer
T7
ID from Seq. Facility
LE_HBa_230_N09-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
350 trimmed for vector and quality, 890 raw
Sequence
>LE_HBa0230N09_T7_405847 (raw untrimmed)
GACTGCCGGCATGCAGCTTATCAAAAGTCTTCCTTACTTCCTCTAGGTTAATTTTAGAGGAAAATTTGAAACTTTATATTTCTTAATATATATGTATACA
TAATACTTAAAATCATAGGCATTCAAAAATAAATAATCTAATAAACAGATATTCAAATGAAAGAATCAACTCATAATTTTATTAAACGTATTTTTGTTAA
AATGGCACTAATATAAAGCCTGCACAAAAGTTGAAAGAAACACTAGTTGAGCATGATCCACTAGCTATATCCTACATCTAACTTAGATAATAACGATAGA
CATCCTTTAAATCATGAGGCTCTACCAAGTCCAGATGAAAGGTCCACGTCCGGATAGCTGCCACGTGAACCTTTAAGCCCTACCATCAACCTGTGCCTGC
TTCTAAAATTGTATAATTTGTATTGGATTAGTACCCACTTGTAATAAGTATGGGTATATGCAAGTACACCCTAAATACCTGCATGAGTAAAAAACACTTC
CTTCCTAATAACCTTATAATGGAAAGTCAAGCCAGTGGACTTTCCTGAAATGGGAATAACAAAATTAGTGACCCTTTCCTAATTTAGATTAGCAACCTGT
TTATTCCCCTTAGAATAACAATGGATCCTTAATACTTATCCTTATTGCTCCCATCCCAAAACTTTTTTATCCCTAATCCATAAACCTTTTCCCTTATACC
CAATAACACCCTTCTTATTAAATCTTCCCACCTACCCCGAAGAACCTAGAAATCCCTGTGGCGCCCATTAAAGAATCCCCCAACTCAAGGGCTTCCCCTC
TATTGGAACCCCACCCACGGTAGTCTTCCTTTATAAAACACAATAGTCCGCCTCTCTTCATTCCTACACAACTTATCTTCACATTATTCA
>LE_HBa0230N09_T7_405847 (trimmed for quality and cloning vector)
AGTCTTCCTTACTTCCTCTAGGTTAATTTTAGAGGAAAATTTGAAACTTTATATTTCTTAATATATATGTATACATAATACTTAAAATCATAGGCATTCA
AAAATAAATAATCTAATAAACAGATATTCAAATGAAAGAATCAACTCATAATTTTATTAAACGTATTTTTGTTAAAATGGCACTAATATAAAGCCTGCAC
AAAAGTTGAAAGAAACACTAGTTGAGCATGATCCACTAGCTATATCCTACATCTAACTTAGATAATAACGATAGACATCCTTTAAATCATGAGGCTCTAC
CAAGTCCAGATGAAAGGTCCACGTCCGGATAGCTGCCACGTGAACCTTTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.929818
Expected error %
0.831742
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0230N09
Clone
Clone name
hba-230n9
LE_HBa0230N09
P230N09
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found