Clone Read LE_HBa0118F14_T7_40587

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118F14_T7_40587
Primer
T7
ID from Seq. Facility
LE_HBa_118_F14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
203 trimmed for vector and quality, 586 raw
Genbank Accession
Sequence
>LE_HBa0118F14_T7_40587 (raw untrimmed)
AAAATTTTTGTGATGTTGTTTGTTCTTTTTTGTTTTTTTTTTTTGTTTGTTTGGGAAAGGTACAAAGCACCTTAGTAACTTGATCGAACAAATCATCAAT
GGCGAGGAAGAGGATACTTGTTCTTAACCGTTACCTTATTCAGTTGTCTGTAGTCTATGC
ACATCCGAAAGCTTCCATCCTTCTTCTTCACAAACAAAAC
AGGAGCACCCCAAGGGGATGCACTTGGTCTAATGAAGCCTTTGCTCAACAACTCTTGAAGTTGAGCCTTTAACTCCCTTAACTCAGTGGGAGCCATTCTA
TAAGGGGGTATAGAAATGGGGCGAGTACCCGGTTCAAGATCGATGCAGAAGTCAATATCTCTATCCGGTGGCATACCAGGAAGGTCTGCATGAACACATC
TAAAAACTCGTGGACTATCGAACCGACTCATTGAATGACTTGGTAGTATCATCCGGAGGCGTGCAAGAAGATAACACCTTACTAATGTCTCTAGCTGAAA
AACGAACATACAACCGATTGAATTTATCACCTCTACCTAATGATTTCCAGCTTGCTAACTCCTGTTTACTACATCAGATGCAATAC
>LE_HBa0118F14_T7_40587 (trimmed for quality and cloning vector)
ACATCCGAAAGCTTCCATCCTTCTTCTTCACAAACAAAACAGGAGCACCCCAAGGGGATGCACTTGGTCTAATGAAGCCTTTGCTCAACAACTCTTGAAG
TTGAGCCTTTAACTCCCTTAACTCAGTGGGAGCCATTCTATAAGGGGGTATAGAAATGGGGCGAGTACCCGGTTCAAGATCGATGCAGAAGTCAATATCT
CTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.975771
Expected error %
0.734126
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 121 E Value 7e-27 Identity 28.40% Align. Length 200bp (98.52%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 119 E Value 2e-26 Identity 27.90% Align. Length 200bp (98.52%) Frame 3
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118F14
Clone
Clone name
hba-118f14
LE_HBa0118F14
P118F14
Clone type
BAC
Contamination
none
Estimated length
100,455
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found