Clone Read LE_HBa0247H24_SP6_407192

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0247H24_SP6_407192
Primer
SP6
ID from Seq. Facility
LE_HBa_247_H24-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
637 trimmed for vector and quality, 937 raw
Sequence
>LE_HBa0247H24_SP6_407192 (raw untrimmed)
TACAACAGTAGCCCAAAAGTTGAGAAGCTGCCAATGCTGAAATATAAGAGCCAGAGATCTGATCTTAGTTCACATAATTGGAAATAGGAAAATGACAAGA
GACATTTGTTCTTGTAGGATAAATATAGTCTTTCATCCAATTGGGAGGTTTAGGAATTCTATTGGACTTTCTAACTGGCTCAACTGAAGTAGACACAGAC
ACAAGAGCATCTTGAAGTGGTATGGAAGGATTAACTTCAAGAGCATGTGGAGGAGAATCATGATCATGACGAACATATATAGACTCAACTGGACAGTATT
GTGTGGAACACAAAGGACGAGAAAATATAGGAGGAAATGTAGTGGACAAGTGTTGAAAAAAATACATCTTCCTTAAACACTACATCTCGATTGATCGTAA
ATGATTTTCCTCATGAAAAAAACATCTTGCGGCCTTTTCGAGTTAAAGAATAACCAAGGAAAACAGCTGAAACAGCCCTAGGTGCAAATTTGCCTGACTT
CTTCAAGGAAGTTACATAACCAAGACAACCAAAAACCTTTAAGTGAGATAAATCTGTTGAGGTCTTAAAGAGAATCTCAACTGGTACTTTACCATGAAGA
GTATGAGAGGGAAACCTATTGACCAGATACACTGCATTGGCCACACAATCTCCACAAAACCTGAGAAGAACACTTGGTTGAAATCTAATAGCTCGAGCAA
TGTCTAAAATGTATCTATGCCTTCTTTCAACAACTCCATTTTGTTGAGGAGTATAAACACTAAAACTCTGATGCACTACCCCTAAGCATTTGATTAAACT
GGGATACTTGAAAATTAAAAACTCACAACCATTGTTAGTTTTCAAAATTTTTACGACTGCCGAAAGGGACATTTTTTTTTCAGGACCAAAAATTCAGCCG
AGGGAAACAATTACTTTTTTGAATGTGAAATTTACAA
>LE_HBa0247H24_SP6_407192 (trimmed for quality and cloning vector)
GCTGCCAATGCTGAAATATAAGAGCCAGAGATCTGATCTTAGTTCACATAATTGGAAATAGGAAAATGACAAGAGACATTTGTTCTTGTAGGATAAATAT
AGTCTTTCATCCAATTGGGAGGTTTAGGAATTCTATTGGACTTTCTAACTGGCTCAACTGAAGTAGACACAGACACAAGAGCATCTTGAAGTGGTATGGA
AGGATTAACTTCAAGAGCATGTGGAGGAGAATCATGATCATGACGAACATATATAGACTCAACTGGACAGTATTGTGTGGAACACAAAGGACGAGAAAAT
ATAGGAGGAAATGTAGTGGACAAGTGTTGAAAAAAATACATCTTCCTTAAACACTACATCTCGATTGATCGTAAATGATTTTCCTCATGAAAAAAACATC
TTGCGGCCTTTTCGAGTTAAAGAATAACCAAGGAAAACAGCTGAAACAGCCCTAGGTGCAAATTTGCCTGACTTCTTCAAGGAAGTTACATAACCAAGAC
AACCAAAAACCTTTAAGTGAGATAAATCTGTTGAGGTCTTAAAGAGAATCTCAACTGGTACTTTACCATGAAGAGTATGAGAGGGAAACCTATTGACCAG
ATACACTGCATTGGCCACACAATCTCCACAAAACCTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.944527
Expected error %
0.507298
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0247H24
Clone
Clone name
hba-247h24
LE_HBa0247H24
P247H24
Clone type
BAC
Contamination
none
Estimated length
73,526
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found