Clone Read LE_HBa0247H24_T7_407194

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0247H24_T7_407194
Primer
T7
ID from Seq. Facility
LE_HBa_247_H24-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
485 trimmed for vector and quality, 850 raw
Sequence
>LE_HBa0247H24_T7_407194 (raw untrimmed)
ATTCGTAATTTCGAATTTAACAGAACAACTCTTAATTATGCCAATGCTGAGCTTGTTCTTGCTTACAAAAAAGAAGAATCCTTCGGGAGACAAAAATCCG
GCATAAAGTGGTTTGTAGAAGGTGAAGTCAATTCCATGTTCTTTCACCCTATGGTTAAAGGCAAAAAAAGACGACTTAACCTGACTACTATTAAAGATGA
TCAAGGTAAGTGGATAGTCCGAGAAGACAATATTGTTGAAGAGGCCATAAAATTCTTTAAACAACAATTCTCTAAAAAAGACACTGTCAAGAATAGTAAA
ATCATGGAGTGTATTCCAAAGTTGATCACTGAGGAAGATAACATCAATCTGATTTCTCCTACTTCATTGGATGAATTGAAAGACATCGTATTTTCCATGA
GCACTCAAAGTGCACCAGGACCAGACGGAGTCTCAGGTAAGTTTTACCATTCTTGGTGGAATATTATTACACATGATTTGCTCATGATGGTACTTGATTT
CTTTGTTGGTACACCTCTTCCTCCATCCCTTAGTCAACTCTTGTCTAATTTTAATTCTAAAGGTTAAAACCTTCAACCTGTAACTGATCGTAAACTGATA
TACCTTTATAAATTTTTCTGGCCCAGATATTCTTTGATTTGCTTAATCCAATATTGCCCCCTATATGATAATATGTATCTCTCCTTATTATATTTTGGTT
TATTAAGCGCTCGTCTTTTTTCTGAATCTATTTTTTTAAGCACATGATATGGTTTTAAACTATCTTTATTCTTTTAATATTTTGGGCTTTTTTGTCTATC
TTTTTTTTTTTAACATTCATTTTCTTATAATTTATTTTTATTTTTTGTAT
>LE_HBa0247H24_T7_407194 (trimmed for quality and cloning vector)
AATTTCGAATTTAACAGAACAACTCTTAATTATGCCAATGCTGAGCTTGTTCTTGCTTACAAAAAAGAAGAATCCTTCGGGAGACAAAAATCCGGCATAA
AGTGGTTTGTAGAAGGTGAAGTCAATTCCATGTTCTTTCACCCTATGGTTAAAGGCAAAAAAAGACGACTTAACCTGACTACTATTAAAGATGATCAAGG
TAAGTGGATAGTCCGAGAAGACAATATTGTTGAAGAGGCCATAAAATTCTTTAAACAACAATTCTCTAAAAAAGACACTGTCAAGAATAGTAAAATCATG
GAGTGTATTCCAAAGTTGATCACTGAGGAAGATAACATCAATCTGATTTCTCCTACTTCATTGGATGAATTGAAAGACATCGTATTTTCCATGAGCACTC
AAAGTGCACCAGGACCAGACGGAGTCTCAGGTAAGTTTTACCATTCTTGGTGGAATATTATTACACATGATTTGCTCATGATGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.953215
Expected error %
0.305537
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0247H24
Clone
Clone name
hba-247h24
LE_HBa0247H24
P247H24
Clone type
BAC
Contamination
none
Estimated length
73,526
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found