Clone Read LE_HBa0247J01_SP6_407296

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0247J01_SP6_407296
Primer
SP6
ID from Seq. Facility
LE_HBa_247_J01-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
226 trimmed for vector and quality, 980 raw
Sequence
>LE_HBa0247J01_SP6_407296 (raw untrimmed)
CCTCAGGATGCTGCCAGATCCTCATAGCCCATCCTCCAACCTTTTGCTTTCTTCGCCGTGTTGTACCCTGTTGGTCAAGTTGTCTAACCCTCTCAGGCAG
GGTTTTTATTAAGATGTCTTTCTGATGGGACTCTGACTCATGGAGGTCATGAGTCAGAGGGGCTTTTTCAACGTATATGGGATTGGGATTGTTGTTCCCA
AAAGTATGTGGGATATTTGTGTTTGGGGTTGTTTCTGGGACAAATGGTTTGGGCTGTTTCTAATAGTGGGGAAATGGAATTTGACAATTTTATTGTATCG
TTGAAAAAATTATTTCTTGTACATTTTAATTTCCTGTTTACTACACAGTATAATGTTCATTTAATGTTTTTTCCAGTTTTCCTGTACCTATTTTTTTTTT
TTCGCTAGGGCGTCCCCATTCCAATTTTTTGGACGATATTTAATGGCCTGCACATTTATTTTTACCCTCCGTGTTGGTGAAACTTCATTTTTCGTATCAT
AAAATCCGTTCATTTCGTTATATGTCACTTTTTAGTTTTATTATATGTTCTATAAGTGGATACTTAATTCCTATTTTTATATTCGTTTTCTGTCCGCTAT
TATGTATTTAATTAATACTAAACTTTCTTTTTCTTTCCCTCACATTTTTTAATTCACGCCTATTTTTATTTATATCTTTTTTTGTCTCCCTAACTAGTTC
TAATTTAGACATTCATTTACTTACTAATGTATATATGCTAAAGAATCATACTCTTTCTCTTTCCTTTTTTAATTTAGCCCTACTATGTCTTGTCTTTAAT
TTTTTTAACATTAATTTATAATATCTACTATCTTTTTTACTTCATTCCACTTTGCACTGTTCTTATCTTTTTCATATCTTTTTTTATGCTTTTATTTATT
TTTTTCTCTCCTATTTAACTTATTAAAGTCTTCATTTTTCTTTCTACTCCATCGGCTTTCTCACGTTATGTCTATTTTGC
>LE_HBa0247J01_SP6_407296 (trimmed for quality and cloning vector)
CAGATCCTCATAGCCCATCCTCCAACCTTTTGCTTTCTTCGCCGTGTTGTACCCTGTTGGTCAAGTTGTCTAACCCTCTCAGGCAGGGTTTTTATTAAGA
TGTCTTTCTGATGGGACTCTGACTCATGGAGGTCATGAGTCAGAGGGGCTTTTTCAACGTATATGGGATTGGGATTGTTGTTCCCAAAAGTATGTGGGAT
ATTTGTGTTTGGGGTTGTTTCTGGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.939844
Expected error %
1.92001
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0247J01
Clone
Clone name
hba-247j1
LE_HBa0247J01
C10HBa0247J01
P247J01
Clone type
BAC
Contamination
none
Estimated length
101,227
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found