Notice: The contact form functionality has been restored. Apologies for any inconvenience.

Clone Read LE_HBa0247J01_T7_407299

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0247J01_T7_407299
Primer
T7
ID from Seq. Facility
LE_HBa_247_J01-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
319 trimmed for vector and quality, 1025 raw
Sequence
>LE_HBa0247J01_T7_407299 (raw untrimmed)
ATGTCGGGGATCCTGAGTCGACCTGCAGGCATGCAAGCTTTTTGTGACTCTGATTGGGCATCCTGCCCATATTCAAAAAGGTCAGTGAGTGGTTATTTAG
GACTACTTGGCAACAGCCCCATAAGCTGGAGATTCAAGAAACAAGAAACTGTCTCTCTATCATCAACTGAAGCAGAGTATAGATAAATTAGAAAGGTGGT
AGGAGAATTAACATGGCTCCACAGATTACTTATTGAGTTTGACTGTTCCTAAATTTTTTGAAGTCCATCACGCATGTACATAGCATATCTACTCAGATAT
GATAAAAATATATTTGTTTCATGTAAATATTATATCAATGTCGCAATTAAACTCAAAATTAAGAAAGTGAAGAAAGAGAATTTAATGATTTAACCTAGTC
CGGAAGAAAATGGAAAACTAAAGGCGGTGGAACAACCCCGTAATTTTTGGATGGAACTTATGGGATGAAAACAAAATTTTCCCTCCCGGGGGTAAACATA
AAGGGCGGTAATTTAAAAATCCCCCAATTTCTACCCAACAAAGTTTTTCTTTCACCAACCCCCCTTTGACCCTTCTTATTTTTTTAATAATAAAATTTTT
TTTTTATTAATTTTAATTAATAAATATGTCCCTTTAATTTTTCTCGCCGGGGGAAAATGGCTATAAACAAAAGGGAAACTCCTTACCCCCTCTGTATTAT
ATACTCTGTTTTTCTTGTTAAAAAGTTTTTTTTTTCCTCCTACACTTTTCCACTGACTGAACACCACCCCCAAAACTATCCGGTTCTTTAAGCCTCCCTG
ACCTAGGCTTGTCCATAATTCGTTACTCTTTCTTTATTATCCTTTTTCTCTCCCAATATATATATATTATACTGATCTTCACACCTAGTATTGGATATGT
TATACCTTTTTTTTTTCTATATGTTTCGGTCATTTTTTATTTACAGCGTCACCTATGCTGTCTCTGTTATCCTTCTACCTCTCCCTAGTCTGTGTATATC
CCTCTCCATTTATTATCTTCTCTAG
>LE_HBa0247J01_T7_407299 (trimmed for quality and cloning vector)
GTCGACCTGCAGGCATGCAAGCTTTTTGTGACTCTGATTGGGCATCCTGCCCATATTCAAAAAGGTCAGTGAGTGGTTATTTAGGACTACTTGGCAACAG
CCCCATAAGCTGGAGATTCAAGAAACAAGAAACTGTCTCTCTATCATCAACTGAAGCAGAGTATAGATAAATTAGAAAGGTGGTAGGAGAATTAACATGG
CTCCACAGATTACTTATTGAGTTTGACTGTTCCTAAATTTTTTGAAGTCCATCACGCATGTACATAGCATATCTACTCAGATATGATAAAAATATATTTG
TTTCATGTAAATATTATAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962105
Expected error %
0.609214
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0247J01
Clone
Clone name
hba-247j1
LE_HBa0247J01
C10HBa0247J01
P247J01
Clone type
BAC
Contamination
none
Estimated length
101,227
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found