Clone Read LE_HBa0118I20_SP6_40742

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118I20_SP6_40742
Primer
SP6
ID from Seq. Facility
LE_HBa_118_I20-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
238 trimmed for vector and quality, 635 raw
Genbank Accession
Sequence
>LE_HBa0118I20_SP6_40742 (raw untrimmed)
GGAGCAACGTCGAATCTCTGGTATGGATTGAACAATTAGGAAGGATGNGGTACATCGTCTGAGTGAATATTTGTTCATTAAATGGTAAAAAATGACCCGA
TTTGTCCCTGCATTTCCTTTAAACGGTCAGGGTCTGAATTTGTTATAATAATTGCGTATGTTGATGATTTGAACATCATTGACACTCATAAAGAGCTTTT
AGAAGTTGTTGAGTGTCTGAAAAAATAATTTGAAATAAAAGATCTTGGGAAGACAAAATTTTATTTGGGCCTGCAGATTGAGAATTTGTCAAATGGAATG
CTTGTTCATCAATCAACGTACACAGAAAAGATACTAAAATTTTTTTTACATGGGATACTCACATTCCATTGAGTACCTCAAATGGTGGTAAAATCCCCTT
GACTTCAAAACCAATTTTTTTTTAACCTCAAAAGGGAAAGAACCTCCTTTCCTTTGTGGGAGTCCAAGGACTAATTGACCCTGTGCAAAAAAAAATCCCA
CCCAAAAATTTTTTTTTTAGGAAAAAGTCTCCCGGGGAAAAATTTTCTTTTCCCCCCCCCAAAAAAAAAAATTGTGAAAGGGGGTTTAAAAAAAATAATT
TTTTAATTTTTTCGGGGGGGGGATTTTGGAAATAT
>LE_HBa0118I20_SP6_40742 (trimmed for quality and cloning vector)
AAAAATGACCCGATTTGTCCCTGCATTTCCTTTAAACGGTCAGGGTCTGAATTTGTTATAATAATTGCGTATGTTGATGATTTGAACATCATTGACACTC
ATAAAGAGCTTTTAGAAGTTGTTGAGTGTCTGAAAAAATAATTTGAAATAAAAGATCTTGGGAAGACAAAATTTTATTTGGGCCTGCAGATTGAGAATTT
GTCAAATGGAATGCTTGTTCATCAATCAACGTACACAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94178
Expected error %
0.283042
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAK84483.1| Score 131 E Value 7e-30 Identity 27.40% Align. Length 236bp (99.16%) Frame 2
putative copia-like polyprotein [Lycopersicon esculentum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAA97087.1| Score 98 E Value 6e-20 Identity 21.10% Align. Length 236bp (99.16%) Frame 2
copia-type pol polyprotein-like [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118I20
Clone
Clone name
hba-118i20
LE_HBa0118I20
P118I20
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found