Clone Read LE_HBa0231M15_SP6_407456

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0231M15_SP6_407456
Primer
SP6
ID from Seq. Facility
LE_HBa_231_M15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
763 trimmed for vector and quality, 852 raw
Sequence
>LE_HBa0231M15_SP6_407456 (raw untrimmed)
NNNCCGCAGTCATANGTTAAATTGATTTGAGACCCANCTGAAGCTAATTCCACAGAACCTGTAAGAAAAAAATAACTCCCAAGCTTCAAAAAGTAACAGG
AAAGAAGAAGGCATAAAAAGCCAACACTCCCTCCGCCCCTGCATGGTACCCCTCATAAAGGAAAATGGGAAAAACCCAAATAACCCACATCCAGCTTCAC
TGGACACGATGAAGAAAATCAAATTCTTTTAAAGAATACAGATAGGGAATATTATGTTCTTCTAATATCACAAGCTGAAGGATAGCAAACATTTTAAATA
GTATAGAAACTAAAGTACATCTGGTAGCCACAACAAAATTAGTTAAGTTATATATGTTAAATCGGTACAAGCATAACCGTTATGCCTACACCATAACAGC
TAGCTACAGAAACTACTAGTCCTCATTTGATGAACTACCACCATCAACGAATTAAGGGTCGTCGTTAATATAAGATCCTAAATTCTCTTCCTTAACGACA
AATTGATGCTAGTCATTGGCATAAGTTTAATATAAGATCCTAATTTCTCTTCCTTAACGACAAATTGAAGCTAGTCGTTGACATAAGTTTCCGCACCACC
CCCCGAATAGAAGATTTTTGTACCAGTTCATCTGTGATCTCAGGGATTCTAAAATTCAACCAAAGAGTTACATAAAAATGCTGAATGTGCAAAAGTTCCA
CCTTACCCAGGCGCCCAATATAAGCAGTCTCCATTAACTGTGCCAAAGGGTCAATGCCCCGTCCAGCAATTGCTGGCAAAGACAGCATCACAAGCTCACG
CCTGACATCCTCAGATTGAGATGAACTTGTCGGAGCCTCTTCTATTGATTCC
>LE_HBa0231M15_SP6_407456 (trimmed for quality and cloning vector)
AGCTAATTCCACAGAACCTGTAAGAAAAAAATAACTCCCAAGCTTCAAAAAGTAACAGGAAAGAAGAAGGCATAAAAAGCCAACACTCCCTCCGCCCCTG
CATGGTACCCCTCATAAAGGAAAATGGGAAAAACCCAAATAACCCACATCCAGCTTCACTGGACACGATGAAGAAAATCAAATTCTTTTAAAGAATACAG
ATAGGGAATATTATGTTCTTCTAATATCACAAGCTGAAGGATAGCAAACATTTTAAATAGTATAGAAACTAAAGTACATCTGGTAGCCACAACAAAATTA
GTTAAGTTATATATGTTAAATCGGTACAAGCATAACCGTTATGCCTACACCATAACAGCTAGCTACAGAAACTACTAGTCCTCATTTGATGAACTACCAC
CATCAACGAATTAAGGGTCGTCGTTAATATAAGATCCTAAATTCTCTTCCTTAACGACAAATTGATGCTAGTCATTGGCATAAGTTTAATATAAGATCCT
AATTTCTCTTCCTTAACGACAAATTGAAGCTAGTCGTTGACATAAGTTTCCGCACCACCCCCCGAATAGAAGATTTTTGTACCAGTTCATCTGTGATCTC
AGGGATTCTAAAATTCAACCAAAGAGTTACATAAAAATGCTGAATGTGCAAAAGTTCCACCTTACCCAGGCGCCCAATATAAGCAGTCTCCATTAACTGT
GCCAAAGGGTCAATGCCCCGTCCAGCAATTGCTGGCAAAGACAGCATCACAAGCTCACGCCTG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.95938
Expected error %
0.250848
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0231M15
Clone
Clone name
hba-231m15
LE_HBa0231M15
P231M15
Clone type
BAC
Contamination
none
Estimated length
127,562
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found