Clone Read LE_HBa0118N08_SP6_40958

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118N08_SP6_40958
Primer
SP6
ID from Seq. Facility
LE_HBa_118_N08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
834 trimmed for vector and quality, 854 raw
Genbank Accession
Sequence
>LE_HBa0118N08_SP6_40958 (raw untrimmed)
GCCGCTAAGCTTTGTCTCATATCGAAACCATTGTCATTTGTATGAATCTTTTCAAGCTCAAGCAACTTAGAATCCAACCCCTTTAGGATCCAATGGTATC
TCACATCAATGTGTTTAGACCCTTCATGGAACGTAGAATTCTTGCCAAGATGTATAGCACTTTGACTGTCACAATAAAGCACATACCTCTCTTGAGCACA
ACCAAGTTCCCCCAAGAATCTCTTCATCCAAAGCAATTCTTTACAAGCTTCAACGACAGCAATAAGCTCAGCTTCTGTAGTAGATAGAGCAACACATTTT
TGCAACCTAGATTGCCAAGACACAGCTCCCCCTGCAAAAGTAACCAAGTACCCTGAAGTAGACTTGCGAGTATCAACATCACCAGCCATGTCTGAATCAG
TATAACCACAAAGAATAGGCTTCCCTGTACCAAAACACAAACTCAGACTAGAAGTGCCACAAAGATATCTCATAACCCACTTCACAACATTCCAATGTTC
TCTTCCCGGATTAGAAAGAAAACGACTAACAACTCCAACAGCGTGAGCAATATCCGGTCTTGTACAAACCATCGCATACATCAAACTACCAACATCTGAA
GCATAAGGAACTTTCTTCATATCTTCCTTCTCATCATCACTAGAAGGACACTGTTTCGTGCTCAATTTGAAGTGCATAGCTAAAGGTGTACTGACAACCT
TAGCTTTGTCCATGCTGAATCTGCGAAGTACTCTCTGAATGTACTTCTCTTGTGATAATACCAATTTCTTGGCCTTTCTATCACGGACAATCTGCGTGCC
AAGAATCTGCCTTGCTGGTCCTAAGTCTTTCATAGCAAAAGACTTACTCAACTC
>LE_HBa0118N08_SP6_40958 (trimmed for quality and cloning vector)
ATCGAAACCATTGTCATTTGTATGAATCTTTTCAAGCTCAAGCAACTTAGAATCCAACCCCTTTAGGATCCAATGGTATCTCACATCAATGTGTTTAGAC
CCTTCATGGAACGTAGAATTCTTGCCAAGATGTATAGCACTTTGACTGTCACAATAAAGCACATACCTCTCTTGAGCACAACCAAGTTCCCCCAAGAATC
TCTTCATCCAAAGCAATTCTTTACAAGCTTCAACGACAGCAATAAGCTCAGCTTCTGTAGTAGATAGAGCAACACATTTTTGCAACCTAGATTGCCAAGA
CACAGCTCCCCCTGCAAAAGTAACCAAGTACCCTGAAGTAGACTTGCGAGTATCAACATCACCAGCCATGTCTGAATCAGTATAACCACAAAGAATAGGC
TTCCCTGTACCAAAACACAAACTCAGACTAGAAGTGCCACAAAGATATCTCATAACCCACTTCACAACATTCCAATGTTCTCTTCCCGGATTAGAAAGAA
AACGACTAACAACTCCAACAGCGTGAGCAATATCCGGTCTTGTACAAACCATCGCATACATCAAACTACCAACATCTGAAGCATAAGGAACTTTCTTCAT
ATCTTCCTTCTCATCATCACTAGAAGGACACTGTTTCGTGCTCAATTTGAAGTGCATAGCTAAAGGTGTACTGACAACCTTAGCTTTGTCCATGCTGAAT
CTGCGAAGTACTCTCTGAATGTACTTCTCTTGTGATAATACCAATTTCTTGGCCTTTCTATCACGGACAATCTGCGTGCCAAGAATCTGCCTTGCTGGTC
CTAAGTCTTTCATAGCAAAAGACTTACTCAACTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.961264
Expected error %
0.352002
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 120 E Value 1e-27 Identity 10.50% Align. Length 761bp (91.25%) Frame 2
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
pir||T02206 Score 430 E Value 1e-119 Identity 24.50% Align. Length 833bp (99.88%) Frame 2
hypothetical protein - common tobacco retrotransposon Tto1 dbj|BAA11674.1| ORF(AA 1-1338) [Nicotiana tabacum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV88069.1| Score 404 E Value 1e-111 Identity 24.20% Align. Length 833bp (99.88%) Frame 2
hypothetical retrotransposon [Ipomoea batatas]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118N08
Clone
Clone name
hba-118n8
LE_HBa0118N08
P118N08
Clone type
BAC
Contamination
none
Estimated length
75,078
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found