Clone Read LE_HBa0118N08_T7_40959

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118N08_T7_40959
Primer
T7
ID from Seq. Facility
LE_HBa_118_N08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
839 trimmed for vector and quality, 912 raw
Genbank Accession
Sequence
>LE_HBa0118N08_T7_40959 (raw untrimmed)
CTTAACCTGGTACCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTATTCTCGGGTTGAAGATGGCCATTGAGGTGAATGTTTATGATTTG
TTGGTTATTGGAGACCCATATCTTTTGATTCATCAGATTCAAGGAGAATGAGATGTGAAGAACGCGAAGATTATACCGTACGTGCAATATATACAGAAGT
TTTGCAAGAGGTTTCGTAAGATCGAATTCAAGCACACTCCCAGAATACAAAATGATTTGGCCGATGCTCTTTCCACCATCGCTTAGATGATTAAACATCC
GGATACAAATTATATTGTTCCTCTAGATATAGAGTTGAAAGAACAACCAGTCCATTGTTCCCATGTTAAAGCAGAACCAGACGGTTTGCCTTGGTATTTT
GATATTAAGAAGTATTTGGAGTCAAGAACTTATCCTGAAGATGCTACGTCCAACAAAAAGAAGTTGATACGCCGTATTGCTCTCAATTTCTTTCTAAGTG
GAGAAGTCCTTTATAGGAGCACTCTAGATTTGGGTCTTCTAAAATGCGTTGATGATGTTTAAGCTGCGAAGCTTATTGAACAGATAGATGCTGGAGTTTA
TGGAACGCATATGAATGGGCTCACTTTGGCAAGAAAGATCCTACGAGCCAAATATTTTTGGATGACTTTGGAGGATGATTGTTGCAAGTTTGTGCAAAAA
TGCCAAAAATGTCAAGTGCACACTGATTTGATACGAGTTTCGCCTCATGAACTTAATGTTATGAGTTCACCTTGGCCCGTTGTAGCTTGGGGCATGGATG
TCATAGGTACCATAGACCCGGCCGATTCTAATGGGACACAGATTTATTTTAGTTGCCTTTACTACTTCACCAAGTGGGTGGAAGAAGCTTCTTACAATCG
GTAACCAGAAAG
>LE_HBa0118N08_T7_40959 (trimmed for quality and cloning vector)
AGCTTGTATTCTCGGGTTGAAGATGGCCATTGAGGTGAATGTTTATGATTTGTTGGTTATTGGAGACCCATATCTTTTGATTCATCAGATTCAAGGAGAA
TGAGATGTGAAGAACGCGAAGATTATACCGTACGTGCAATATATACAGAAGTTTTGCAAGAGGTTTCGTAAGATCGAATTCAAGCACACTCCCAGAATAC
AAAATGATTTGGCCGATGCTCTTTCCACCATCGCTTAGATGATTAAACATCCGGATACAAATTATATTGTTCCTCTAGATATAGAGTTGAAAGAACAACC
AGTCCATTGTTCCCATGTTAAAGCAGAACCAGACGGTTTGCCTTGGTATTTTGATATTAAGAAGTATTTGGAGTCAAGAACTTATCCTGAAGATGCTACG
TCCAACAAAAAGAAGTTGATACGCCGTATTGCTCTCAATTTCTTTCTAAGTGGAGAAGTCCTTTATAGGAGCACTCTAGATTTGGGTCTTCTAAAATGCG
TTGATGATGTTTAAGCTGCGAAGCTTATTGAACAGATAGATGCTGGAGTTTATGGAACGCATATGAATGGGCTCACTTTGGCAAGAAAGATCCTACGAGC
CAAATATTTTTGGATGACTTTGGAGGATGATTGTTGCAAGTTTGTGCAAAAATGCCAAAAATGTCAAGTGCACACTGATTTGATACGAGTTTCGCCTCAT
GAACTTAATGTTATGAGTTCACCTTGGCCCGTTGTAGCTTGGGGCATGGATGTCATAGGTACCATAGACCCGGCCGATTCTAATGGGACACAGATTTATT
TTAGTTGCCTTTACTACTTCACCAAGTGGGTGGAAGAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.96949
Expected error %
0.983083
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39963.1| Score 228 E Value 1e-58 Identity 14.10% Align. Length 833bp (99.28%) Frame 3
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ82037.1| Score 221 E Value 1e-56 Identity 12.80% Align. Length 833bp (99.28%) Frame 3
gag/pol polyprotein [Pisum sativum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118N08
Clone
Clone name
hba-118n8
LE_HBa0118N08
P118N08
Clone type
BAC
Contamination
none
Estimated length
75,078
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found