Clone Read LE_HBa0118P05_SP6_41048

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118P05_SP6_41048
Primer
SP6
ID from Seq. Facility
LE_HBa_118_P05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
526 trimmed for vector and quality, 902 raw
Genbank Accession
Sequence
>LE_HBa0118P05_SP6_41048 (raw untrimmed)
GCGCACGTTTAGCGGGCGCAAGTAGGCAAAAGAATATGCAGACCGAAAGGTTAGAGACGTAGAGTTCATGGAGGGCCATCAAGTCTTGTTGAAAGTTTCC
CCAATGAAAGGGGTGATCTTTTTTTGGTAAAAGAGGTAAACTTAGCCCAAGGTATATTGGTCCATTTGAAGTACTAAAGCGAGTAGGGGAGGTGGCTTAT
GAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGTGTATCCGGTATTCCATGTGTCGATGTTGAAAAGATACCATGGGGATGGAAACTACATTATCCGTTGGG
ATTCAGTTTTGCTTGATGAGAATTTGTCTTATGAGGAGGAACCTGTTGCCATTCTAGATAGGGAAATTCACATGTTAAGATCAAGGGAGATTGCATCCAT
CAAAGTTCAATGGAAGAATAAACCCGTTGAAGAAGCCACTTGGGAGAAGGAGGCGGATATGCGAGAAAAATACCCACATCTGTTTACAGATTCAGGTACT
CCTTTTCGCCCTTGTTTTCCTTCTTGTGATCGTTCGGGGACGAACGATGGGTAAATTGGTATCTATTGTAACGACCTGTTTAGTCGTTTTGAGCAGCAGA
TTTCAATTCTGGAAAAACTGGCAGAATCGACGGACCCCACGACGGACTCTCATGGGCACGACGGACCCTCGCATGGACTCGTTTTAAAAAACTTAGAAAA
ACTCACATTACGTACTTAAAATTTACTCTTCTTATACTCTTATCTAAAAGGCCTGACGTATCGCTAATGGTTTGGTTGAATCTTCTCTGACTCTTCTAAA
AAGTTGTTTTTTGTATACTTTCATCTCTCTTTTGAACCTTTCTCTTTCACTTTTGGTGTGCTCTATTAATTGAACAACCCATTATTATCTGAATCTTATT
TA
>LE_HBa0118P05_SP6_41048 (trimmed for quality and cloning vector)
AATATGCAGACCGAAAGGTTAGAGACGTAGAGTTCATGGAGGGCCATCAAGTCTTGTTGAAAGTTTCCCCAATGAAAGGGGTGATCTTTTTTTGGTAAAA
GAGGTAAACTTAGCCCAAGGTATATTGGTCCATTTGAAGTACTAAAGCGAGTAGGGGAGGTGGCTTATGAGTTAGCCTTGCCTCCAGGGCTGTCCGGAGT
GTATCCGGTATTCCATGTGTCGATGTTGAAAAGATACCATGGGGATGGAAACTACATTATCCGTTGGGATTCAGTTTTGCTTGATGAGAATTTGTCTTAT
GAGGAGGAACCTGTTGCCATTCTAGATAGGGAAATTCACATGTTAAGATCAAGGGAGATTGCATCCATCAAAGTTCAATGGAAGAATAAACCCGTTGAAG
AAGCCACTTGGGAGAAGGAGGCGGATATGCGAGAAAAATACCCACATCTGTTTACAGATTCAGGTACTCCTTTTCGCCCTTGTTTTCCTTCTTGTGATCG
TTCGGGGACGAACGATGGGTAAATTG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.963628
Expected error %
0.547987
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 161 E Value 4e-43 Identity 61.70% Align. Length 465bp (88.40%) Frame 1
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV31169.1| Score 156 E Value 2e-41 Identity 60.80% Align. Length 465bp (88.40%) Frame 1
putative polyprotein [Solanum tuberosum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118P05
Clone
Clone name
hba-118p5
LE_HBa0118P05
P118P05
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found