Clone Read LE_HBa0118P10_T7_41059

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118P10_T7_41059
Primer
T7
ID from Seq. Facility
LE_HBa_118_P10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
329 trimmed for vector and quality, 779 raw
Genbank Accession
Sequence
>LE_HBa0118P10_T7_41059 (raw untrimmed)
TTTTTTTTCCGCGCCGCGGGGGAACGATGTAGGTGCTTGGTGTTAACCATTGACAGGATCTTATTAGCTCCGATACCAATTGATAGAAACCGAGGTTTTA
ACTAAATAAAAACAACAGAAAATACAAAGAAAGACACAAGTATCTCGTATCTCGAAGAAAAATAGAAAATACAAAGAGAGAGTGAGAGACAAGTATCTCG
TATCTCTGAGAACAACCTTTTGTCCATATAAAATATATATTACCATATGTCTACTTATTTGCTGGATCTCCTATTATATAATAGATAACTGATAACTACT
TTATAACTATTTAGGATAAGAATATATAACTTCTAGTAACCATAAGAAACTGCCAAATTACTTGCAAATCAATATCTTCTCCTATCTTTCTTCACTTCTT
CCTCCTTGAATAAGAATGGAAGATACGTGCCTTATCACATAGCATCTGCAATTTTCCTCGCATTAGGTTTTGAATGCACAATGTTTCTTTTTCTTGAATT
CCATGTTTAATAACCCCTATTTCACTAAGTCTGCCTTAAGACTGTTGGGAAGGTATAGATCAGAAATGGGTGAAACACAAGAATGTTCTGTCTCGTTGAA
AATCCCCGGTGTTTCTTCGTTCTATTGCCTTTCACTCTGGGTTTGTATTTCTGCTTTGGGTGATGTGCGGGTCCTGATATTAAGAAGGTATTTATTTCTA
ACTTCCTCAATATGACTTGTATTATATCGTAACTTTCTGTCCTGCTCCGCGACTTTACTGCTCGCTGTATGTGTTCGTC
>LE_HBa0118P10_T7_41059 (trimmed for quality and cloning vector)
TAGAAACCGAGGTTTTAACTAAATAAAAACAACAGAAAATACAAAGAAAGACACAAGTATCTCGTATCTCGAAGAAAAATAGAAAATACAAAGAGAGAGT
GAGAGACAAGTATCTCGTATCTCTGAGAACAACCTTTTGTCCATATAAAATATATATTACCATATGTCTACTTATTTGCTGGATCTCCTATTATATAATA
GATAACTGATAACTACTTTATAACTATTTAGGATAAGAATATATAACTTCTAGTAACCATAAGAAACTGCCAAATTACTTGCAAATCAATATCTTCTCCT
ATCTTTCTTCACTTCTTCCTCCTTGAATA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.903407
Expected error %
0.464614
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118P10
Clone
Clone name
hba-118p10
LE_HBa0118P10
P118P10
Clone type
BAC
Contamination
none
Estimated length
121,784
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found