Clone Read LE_HBa0118P14_SP6_41066

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118P14_SP6_41066
Primer
SP6
ID from Seq. Facility
LE_HBa_118_P14-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
789 trimmed for vector and quality, 827 raw
Genbank Accession
Sequence
>LE_HBa0118P14_SP6_41066 (raw untrimmed)
TGTGGGTTGGGTTGGTTTTGTTGTTCTCAGTAAACCTGGTTATCAACATCAAAGTTCACATCTCAAAAATGCACCATTAAGCTTTCAGTGATACCTAATG
TAACAGTGAGAAGATATTTGTTCCTTACAGTCCTGAGGTGGCGGAAACGGAAGTGAAGGTTCTGCTGTCGAAGCATAGAACACAATGAGATTTGTGAATG
CATCAAGGAAAAATATCGAACTGCCACTTGTAATCAGTGCAGCTCGGCTGAGGGAATGTCGAGGATATGCTTGCTTATCCGGTGAGGCATATGAGGTTAA
CAATGGATATACAGCACGACTAAGAGAAGAAGGTTCTAGTGCACTGCATCAAAAGTCCAAAGTCGTTAACAATAAGATTTACCACCCATCACCCCACAAA
AAATTGACAGCAAATCAAAATATCACAATACAAGGAGTGACGGTCATCATTTAAACATAAGTTGAAAGGCCATATTTCCTCTTTCTCTTCTTTTATCTTT
TTATGTAGTGACAGATACTGTGATTGTGTGCACTCCAGAGACAACATATAAAGTTCTCTTATGTATACCACCATTATAACCCAATGAACTGTTGAAGATA
TGTTTTAAGCAGAAAACTGAAATAAGGTGGCATCTCTATTTGACCAAATCTTTTAGAGTAAGATGTAAATACTACACGTGTCACTCCAGAGATGATAGTT
CATCTTTTACTAGATAACAAGTTAATGAAGAACTTTGCGTCTTTGTGAACGGAAAAAAAAGTTTGGTATCACTATGTGTCTATGTCCATAACCATACTAA
ACTAGGTAGTGCTAAAAAAACTATACT
>LE_HBa0118P14_SP6_41066 (trimmed for quality and cloning vector)
ACCTGGTTATCAACATCAAAGTTCACATCTCAAAAATGCACCATTAAGCTTTCAGTGATACCTAATGTAACAGTGAGAAGATATTTGTTCCTTACAGTCC
TGAGGTGGCGGAAACGGAAGTGAAGGTTCTGCTGTCGAAGCATAGAACACAATGAGATTTGTGAATGCATCAAGGAAAAATATCGAACTGCCACTTGTAA
TCAGTGCAGCTCGGCTGAGGGAATGTCGAGGATATGCTTGCTTATCCGGTGAGGCATATGAGGTTAACAATGGATATACAGCACGACTAAGAGAAGAAGG
TTCTAGTGCACTGCATCAAAAGTCCAAAGTCGTTAACAATAAGATTTACCACCCATCACCCCACAAAAAATTGACAGCAAATCAAAATATCACAATACAA
GGAGTGACGGTCATCATTTAAACATAAGTTGAAAGGCCATATTTCCTCTTTCTCTTCTTTTATCTTTTTATGTAGTGACAGATACTGTGATTGTGTGCAC
TCCAGAGACAACATATAAAGTTCTCTTATGTATACCACCATTATAACCCAATGAACTGTTGAAGATATGTTTTAAGCAGAAAACTGAAATAAGGTGGCAT
CTCTATTTGACCAAATCTTTTAGAGTAAGATGTAAATACTACACGTGTCACTCCAGAGATGATAGTTCATCTTTTACTAGATAACAAGTTAATGAAGAAC
TTTGCGTCTTTGTGAACGGAAAAAAAAGTTTGGTATCACTATGTGTCTATGTCCATAACCATACTAAACTAGGTAGTGCTAAAAAAACT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.964263
Expected error %
0.118754
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g27460.1 Score 118 E Value 4e-27 Identity 25.10% Align. Length 218bp (27.63%) Frame 2
68415.m03319 sec23/sec24 transport family protein weak similarity to SP|P53992 Protein transport protein Sec24C (SEC24-related protein C) {Homo sapiens}; contains Pfam domains PF04811: Sec23/Sec24 trunk domain, PF04815: Sec23/Sec24 helical domain and PF04810: Sec23/Sec24 zinc finger
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|XP_475332.1| Score 119 E Value 7e-26 Identity 25.10% Align. Length 218bp (27.63%) Frame 2
'unknown protein, contains Sec23/Sec24 trunk domain, PF04811' [Oryza sativa (japonica cultivar-group)] gb|AAT69610.1| unknown protein [Oryza sativa (japonica cultivar-group)] gb|AAU90101.1| unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAQ56782.1| Score 118 E Value 2e-25 Identity 25.10% Align. Length 218bp (27.63%) Frame 2
At2g27460 [Arabidopsis thaliana] gb|AAD15598.1| expressed protein [Arabidopsis thaliana] gb|AAK96686.1| Unknown protein [Arabidopsis thaliana] pir||B84673 hypothetical protein At2g27460 [imported] - Arabidopsis thaliana ref|NP_565651.1| sec23/sec24 transport family protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118P14
Clone
Clone name
hba-118p14
LE_HBa0118P14
P118P14
Clone type
BAC
Contamination
none
Estimated length
115,335
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found