Clone Read LE_HBa0118P14_T7_41067

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0118P14_T7_41067
Primer
T7
ID from Seq. Facility
LE_HBa_118_P14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
823 trimmed for vector and quality, 892 raw
Genbank Accession
Sequence
>LE_HBa0118P14_T7_41067 (raw untrimmed)
CGTAAACCGGTACCGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCTTCTCTTTTTTTTTTCCACCCAATATGGACCACATTAATCAATTAGC
AATGTTACTTTTGTACTACTAAATCAAATTAGCAAATTTATTTATTTATTACAAAATGGACCATACTAAATTTTAGACTATTCCTACATAGTCAATTGAC
TATAAATGAAAACTTTATGATTTGTAAAATTTGTCAGGAGTTCGTACTATAAATTTCAATCGTGGGATTGACGAGAACTGAGTGTACGAAAATCTTATTT
TTATTCAATAAAAATAAGAAAATTATTTTCAAAAGATCTTTAATTCAATTAATATGTGTTAAAATAATTTTCAAAAAACGTTATGTGGTATCTAGCAAAA
AAAAAAAAGGAACAATATGAACAAACTAATTATGTGATAATTGAAGCACAAAAAATAATATATAATAATTATAATAATCGAAGGATCAAATACTATGAAA
ATAATACTAATACTATTGATGTAAAAGATGAAATAGATATTGTATATCAAATTACCAGAGCTCTCAATTTCTTATAATACCTTTTTTATTAATTTCTTAA
ATTAAAAATAATCGACGAATATATAATACGTATATAACCGTATACATGTTTAACTTAAAGTACATGTATCAAGGCTTAACTTTTCTTTTTTCATTTCACT
AAAATGGATTAGCTTAACACAATGTGTTGTATACTATGCAACACAAATTATTATAATAATTTTCAATAAAATCAAAATTGTACCTTATATTTATCACTAT
GCACGGAGTCAAAGAAAAAGTGGACTAAAACATATTGTTAACATCTTACCTTATATTTACGTATATTTACCTAAGAAACTAGCTCCATAGTT
>LE_HBa0118P14_T7_41067 (trimmed for quality and cloning vector)
AGCTTCTTCTCTTTTTTTTTTCCACCCAATATGGACCACATTAATCAATTAGCAATGTTACTTTTGTACTACTAAATCAAATTAGCAAATTTATTTATTT
ATTACAAAATGGACCATACTAAATTTTAGACTATTCCTACATAGTCAATTGACTATAAATGAAAACTTTATGATTTGTAAAATTTGTCAGGAGTTCGTAC
TATAAATTTCAATCGTGGGATTGACGAGAACTGAGTGTACGAAAATCTTATTTTTATTCAATAAAAATAAGAAAATTATTTTCAAAAGATCTTTAATTCA
ATTAATATGTGTTAAAATAATTTTCAAAAAACGTTATGTGGTATCTAGCAAAAAAAAAAAAGGAACAATATGAACAAACTAATTATGTGATAATTGAAGC
ACAAAAAATAATATATAATAATTATAATAATCGAAGGATCAAATACTATGAAAATAATACTAATACTATTGATGTAAAAGATGAAATAGATATTGTATAT
CAAATTACCAGAGCTCTCAATTTCTTATAATACCTTTTTTATTAATTTCTTAAATTAAAAATAATCGACGAATATATAATACGTATATAACCGTATACAT
GTTTAACTTAAAGTACATGTATCAAGGCTTAACTTTTCTTTTTTCATTTCACTAAAATGGATTAGCTTAACACAATGTGTTGTATACTATGCAACACAAA
TTATTATAATAATTTTCAATAAAATCAAAATTGTACCTTATATTTATCACTATGCACGGAGTCAAAGAAAAAGTGGACTAAAACATATTGTTAACATCTT
ACCTTATATTTACGTATATTTAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.883768
Expected error %
0.504132
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0118P14
Clone
Clone name
hba-118p14
LE_HBa0118P14
P118P14
Clone type
BAC
Contamination
none
Estimated length
115,335
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found