Clone Read LE_HBa0119D16_T7_41263

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0119D16_T7_41263
Primer
T7
ID from Seq. Facility
LE_HBa_119_D16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
444 trimmed for vector and quality, 883 raw
Genbank Accession
Sequence
>LE_HBa0119D16_T7_41263 (raw untrimmed)
CTCACTTCGTACCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAACTCTTGAGGGTTTCCCCCTGAAGGTACTTAATCAAGCCTCCAC
ATCTGTGTCTATTGCTTTGAAGTTATATACTTGCTTTGTCCGAAGTGCGTCCTAAAGCCTAAGATTCATCATTGACATGTCAAACTTGTGCATCTTTCTG
TTGGTTAGCCTTTCCATAGTTGTCTCCTTGAAAAAGAAAATGAGAGATGCATTCGGAGAAGGAAAAGGGGGAAGTAATAAATTCCAAGTCTCTTTGTTAG
ATTCTCATAGTCCAATTTAATCCAAACAAACTTGTTTACTGCACAATAGTGTTATTATCATCAACACCCTTTTGAAGTACAAGCAATGAGAGGCCAGGGG
AGGAAAAGGTTATTGAAAACCAAATTTTTTGTTTAGAATTGAATTCGTGCTAACTACAATGAAAGTGAATCTACGAACCCCCCCATTCTTATTAAGTGCC
ACAAAAATAAACATATGAGGAACTACTTTCGGCTCCTCTCATATAATATACGTCTTTTGCACCCTCCGCTATTCCTTGCTAACTTGATATCCTCTTCTCG
CGTTTACTTGAATCTATTTCGCTACTTCCTTTCTTTTATTGTTGTTTATTCTTCATGTTAGTACTAATGTCTTTCTTCCTGTTCTTTTCTCTTTTTTCAT
GTATTTCCCGTTTTTTTTTTTATGTTGTATGTATAATATTTTTTTCCCCCCCCCCAAAATGGTTTTATATTTTAGAAATTTCAATTACTTGTTTTATATT
AATGATTTGTTTTTGATTTATAATTGAAAAGAAGGTAATGGATAATTGGATTAAATTGAATTGCTGTGTTCCCAGCCTCCTCT
>LE_HBa0119D16_T7_41263 (trimmed for quality and cloning vector)
AGCTTGGAACTCTTGAGGGTTTCCCCCTGAAGGTACTTAATCAAGCCTCCACATCTGTGTCTATTGCTTTGAAGTTATATACTTGCTTTGTCCGAAGTGC
GTCCTAAAGCCTAAGATTCATCATTGACATGTCAAACTTGTGCATCTTTCTGTTGGTTAGCCTTTCCATAGTTGTCTCCTTGAAAAAGAAAATGAGAGAT
GCATTCGGAGAAGGAAAAGGGGGAAGTAATAAATTCCAAGTCTCTTTGTTAGATTCTCATAGTCCAATTTAATCCAAACAAACTTGTTTACTGCACAATA
GTGTTATTATCATCAACACCCTTTTGAAGTACAAGCAATGAGAGGCCAGGGGAGGAAAAGGTTATTGAAAACCAAATTTTTTGTTTAGAATTGAATTCGT
GCTAACTACAATGAAAGTGAATCTACGAACCCCCCCATTCTTAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.957733
Expected error %
1.67365
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0119D16
Clone
Clone name
hba-119d16
LE_HBa0119D16
C11HBa0119D16
P119D16
Clone type
BAC
Contamination
none
Estimated length
116,905
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found