Clone Read LE_HBa0119G11_T7_41397

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0119G11_T7_41397
Primer
T7
ID from Seq. Facility
LE_HBa_119_G11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
581 trimmed for vector and quality, 907 raw
Genbank Accession
Sequence
>LE_HBa0119G11_T7_41397 (raw untrimmed)
CTCAGCTGGGCCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAGCTTATTTTGTGGGGAAGAGGCCGGAGGTGTTAAGTATCTCATTTTG
TTAGTCAATGGAGGTTGTTGTCTCATTAATTATATGACTTTGAATAATTCGTATCTTATGAATTATCTTTAACGTTGAATTATCTAGACCTAATATTATT
ATTTTTCACGCAAATTACCTTATTCGGTGGAATGGAGGTAGTTATTTGATAGTGTTTGCCAACATATTGACTCAAATACTACTAAGCTCACATTTTGACC
CTTTATGTCATTTTAATTTGATTGAACATTAAATTTAAAATATAATATTTTGATCTTTGTAAATCAAAAGAAATATGTATAAAATATATGTCATTAGGTA
TAATAATTTTAAAAATGTCAAGTGAATAATTAAAGTTTAAAGAGTTACTACTATACAAGTGAAATAATATTTAAAAATTGTCTGAAATTCAATTTCGAAA
TTAAAAAAATTAAAAAATGTCCTGGCCAAATAGGATCGTCGTCCCATTATCCCTTTTTTACTAAGATTTATAGATGTAATAACATTTAAATTTATTGCTA
TCTCGACTGTATATATGGTGTGAGAAATCAAGACTAAGGGGTGGTCAAGGGAATGAGAATTAAAGAGAAAATCCAAATCTAAAGTAATAGAATTATAATT
TTTGATCTGTAAATATTATTGACCATATTTTTCTTATTGTGTTTATGGATGGGTATAGACTTCTTTCCAATGAGGGACACTGGAGAAAGGGGGAGGGCGT
TGGCGGGGCGGCGAGGGCTAGTGGATTTCCGTGGCTTAGTGGTCTGATTTTCGTAAGTAATATTCTTATGGCGTCTTCATTTCCCCACTCCCTCGAGTAG
CCCCTTC
>LE_HBa0119G11_T7_41397 (trimmed for quality and cloning vector)
AGCTTAGCTTATTTTGTGGGGAAGAGGCCGGAGGTGTTAAGTATCTCATTTTGTTAGTCAATGGAGGTTGTTGTCTCATTAATTATATGACTTTGAATAA
TTCGTATCTTATGAATTATCTTTAACGTTGAATTATCTAGACCTAATATTATTATTTTTCACGCAAATTACCTTATTCGGTGGAATGGAGGTAGTTATTT
GATAGTGTTTGCCAACATATTGACTCAAATACTACTAAGCTCACATTTTGACCCTTTATGTCATTTTAATTTGATTGAACATTAAATTTAAAATATAATA
TTTTGATCTTTGTAAATCAAAAGAAATATGTATAAAATATATGTCATTAGGTATAATAATTTTAAAAATGTCAAGTGAATAATTAAAGTTTAAAGAGTTA
CTACTATACAAGTGAAATAATATTTAAAAATTGTCTGAAATTCAATTTCGAAATTAAAAAAATTAAAAAATGTCCTGGCCAAATAGGATCGTCGTCCCAT
TATCCCTTTTTTACTAAGATTTATAGATGTAATAACATTTAAATTTATTGCTATCTCGACTGTATATATGGTGTGAGAAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.910895
Expected error %
0.416048
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0119G11
Clone
Clone name
hba-119g11
LE_HBa0119G11
P119G11
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found