Clone Read LE_HBa0119I16_SP6_41502

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0119I16_SP6_41502
Primer
SP6
ID from Seq. Facility
LE_HBa_119_I16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
441 trimmed for vector and quality, 894 raw
Genbank Accession
Sequence
>LE_HBa0119I16_SP6_41502 (raw untrimmed)
CCGAAGATTTTTGAATTGAAATTGTTGATGGATTTTTGTTATAGTAATTCTAATAACAAAATACTGGCTTTTTTGGTCTTTTTGATATGAATTGTAAAGT
AATTGACATGGATGAACAACTTATCAATTGTGAAGTTTATCATGAAGATTGTAGTGATAAGTTTCTACTTACCTGTGTTTATGCAAAGTGTAAGGAACAT
CTGAGGAAGCCTCTTTGGGATAGGTTAATCCAATGGTCTGATTTGGATAAACCTTGGTGCATTATTGGAGACTTTAATGTGATATCCTCCATTGATGAAA
AATTGGGTGGAAGAGACTAAAATATCAATAAAAGTTTTGATTTCATCAACATAATAGAATCATGTGGTTTAATTGATTTAGGATATAGTGGTCAGCCTTT
CACATGGTGTAATCATAGGAAGGGTAATGCTAGAATCTGGAAAAGATTGGATAGAGGATTGGTCAATGATAATTGGTTAAGGATTATGCCTAACTCTTTC
TATAATTTATTTACCTTCTGTGTGGTTCTGATCTTTGTCCATTTCATATGGAGAATAACAGTGATAATGAAAATGCTATAAAATGTGTTGAGTTCCTTAA
CTGGTGGACTGAACAAGATACTTTATCTTCTACTGTGTAAATATGTCTAATGACACATTGGACTCGTGTTCAAAGCTTTATTTATTTTTTATTACTTATA
TCTTTTTTTTTTATTATCTTTTCTTCTCTTTAATATTTTTTTTTCTTTTTCATTTATTTTCTCCTTCTATTACAAGTATATTCTGCGTTTTTAGCTTTTG
TTCCTTTCATTTGCCCTTTACTTAACAATACTCTCGTACTATCATATACTTCTTAAAAAGTGTAGACACTACAACAAACCGACGCCGGAACTAT
>LE_HBa0119I16_SP6_41502 (trimmed for quality and cloning vector)
TTTTTGTTATAGTAATTCTAATAACAAAATACTGGCTTTTTTGGTCTTTTTGATATGAATTGTAAAGTAATTGACATGGATGAACAACTTATCAATTGTG
AAGTTTATCATGAAGATTGTAGTGATAAGTTTCTACTTACCTGTGTTTATGCAAAGTGTAAGGAACATCTGAGGAAGCCTCTTTGGGATAGGTTAATCCA
ATGGTCTGATTTGGATAAACCTTGGTGCATTATTGGAGACTTTAATGTGATATCCTCCATTGATGAAAAATTGGGTGGAAGAGACTAAAATATCAATAAA
AGTTTTGATTTCATCAACATAATAGAATCATGTGGTTTAATTGATTTAGGATATAGTGGTCAGCCTTTCACATGGTGTAATCATAGGAAGGGTAATGCTA
GAATCTGGAAAAGATTGGATAGAGGATTGGTCAATGATAAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.917531
Expected error %
0.444569
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC67331.1| Score 80 E Value 2e-14 Identity 14.00% Align. Length 356bp (80.73%) Frame 2
putative non-LTR retroelement reverse transcriptase [Arabidopsis thaliana] pir||B84426 hypothetical protein At2g01550 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC95175.1| Score 74 E Value 1e-12 Identity 13.60% Align. Length 353bp (80.05%) Frame 2
putative non-LTR retroelement reverse transcriptase [Arabidopsis thaliana] pir||G84473 hypothetical protein At2g05980 [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0119I16
Clone
Clone name
hba-119i16
LE_HBa0119I16
C01HBa0119I16
P119I16
Clone type
BAC
Contamination
none
Estimated length
116,481
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found