Clone Read LE_HBa0119I16_T7_41503

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0119I16_T7_41503
Primer
T7
ID from Seq. Facility
LE_HBa_119_I16-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
377 trimmed for vector and quality, 941 raw
Genbank Accession
Sequence
>LE_HBa0119I16_T7_41503 (raw untrimmed)
TCGACCTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTCATGGACCTGATATTGGGGCCATCACAGTATTACTCTATAAAGCTGG
AACATCTGGTTCTGTAGCACCCCAAGCTGGGTTTGTTACATTTGATGAAAGATTTAAGATATTGAGAGAAGTTCAATGGGAGTCGTTCAGCTCAAATGTG
CCTTTGTCTGCTGGTGTTGTAACGCATTGAGATTGTGGCGATATTCTGTTTTGATTATCCATTATATGACTTCTATCTCCACCATTCCCAGTAGAAACAA
AGAGAAGCTGCGAGCACAAGGGGGGTTTTCTTGTGTTTGCATCTCGTCTGGAATCAAAGAGGGCTACCATCTCTAGCGGGATTCCTTTTCTGTATCTTCC
CCCTCCCCCTCCCTTTTCCTTTTTTTTTTTCTTCTTCCTTCCCTCCTCTCCTTCTCCCTTTTTTTTTTTTCTTCCCTCCCCTTTCCCCTTCCTTCTCCTT
TCTCTTCCTTCTTTTCTTCTTCTTTTCCTTTTCTTTCTTTTTTCTTTTCTTTTTTCTTTTTTTTTTCCCTCCTTCTCTCTTTTTCCTCTCCTCNCTTTCT
TCTNTTTCCTTCTTTTTCTTTTTTTTCTTTCTCTCTTCCTTTTTCTCCCCTCCTCTTCTTTTCTTTCCTCTCTTCTTCTCTTCTTTTGTTCTCTCCCTCT
CTCCTTCTTCTCCTCTTTTTTCTAATTTTCTCCATCTTACTCATCCATCTTTTCATATTTTCTTCTNTTACTACTCTTTATCATACTAATCACATCCTNT
CTATATTTAATCTACATCATAAACTCTATACTTACATTATCTCTTCCTTTTCTTACTACCTATATTCTACTAACTCCATTCTTATTATCTTACTTTTTCT
TCCTCCTCCTCATCATCTCCCTCCCATTCTCCCCTCTCTCC
>LE_HBa0119I16_T7_41503 (trimmed for quality and cloning vector)
AGCTTCATGGACCTGATATTGGGGCCATCACAGTATTACTCTATAAAGCTGGAACATCTGGTTCTGTAGCACCCCAAGCTGGGTTTGTTACATTTGATGA
AAGATTTAAGATATTGAGAGAAGTTCAATGGGAGTCGTTCAGCTCAAATGTGCCTTTGTCTGCTGGTGTTGTAACGCATTGAGATTGTGGCGATATTCTG
TTTTGATTATCCATTATATGACTTCTATCTCCACCATTCCCAGTAGAAACAAAGAGAAGCTGCGAGCACAAGGGGGGTTTTCTTGTGTTTGCATCTCGTC
TGGAATCAAAGAGGGCTACCATCTCTAGCGGGATTCCTTTTCTGTATCTTCCCCCTCCCCCTCCCTTTTCCTTTTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.970579
Expected error %
0.312861
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At5g64050.1 Score 70 E Value 3e-13 Identity 19.80% Align. Length 161bp (42.71%) Frame 1
68418.m08042 glutamate-tRNA ligase family protein / glutamyl-tRNA synthetase family protein similar to SP|P22250 from Bacillus subtilis, SP|P22249 from Bacillus stearothermophilus; contains Pfam tRNA synthetases class I (E and Q), catalytic domain PF00749
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA58506.1| Score 109 E Value 2e-23 Identity 30.50% Align. Length 173bp (45.89%) Frame 1
glutamate--tRNA ligase [Nicotiana tabacum] pir||S51685 glutamate-tRNA ligase (EC 6.1.1.17) - common tobacco sp|Q43794|SYE_TOBAC Glutamyl-tRNA synthetase (Glutamate--tRNA ligase) (GluRS)
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB10273.1| Score 70 E Value 2e-11 Identity 19.80% Align. Length 161bp (42.71%) Frame 1
glutamate-tRNA ligase [Arabidopsis thaliana] ref|NP_201210.1| glutamate-tRNA ligase family protein / glutamyl-tRNA synthetase family protein [Arabidopsis thaliana] gb|AAG29098.1| Glu-tRNA synthetase [Arabidopsis thaliana] sp|Q9FEA2|SYE_ARATH Glutamyl-tRNA synthetase (Glutamate--tRNA ligase) (GluRS)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0119I16
Clone
Clone name
hba-119i16
LE_HBa0119I16
C01HBa0119I16
P119I16
Clone type
BAC
Contamination
none
Estimated length
116,481
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found