Clone Read LE_HBa0009H10_SP6_4194

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009H10_SP6_4194
Primer
SP6
ID from Seq. Facility
LE_HBa_009_H10-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
665 trimmed for vector and quality, 846 raw
Genbank Accession
Sequence
>LE_HBa0009H10_SP6_4194 (raw untrimmed)
GGCAATAAATTAAAATTAAATGGCTCGCTTTAGATGCTGATATTTCTTTTTATGTCAATGTAATCGTCATCTTTTTTACTTTAACTAACATAAAAGAATG
CAGTTGATGCCAACGGATAAATATTTCTCTTCGGATTCATGATTCTTTCTCCGGCAGTGCAAGATTTCTTACGGGACATGAATATCTTCCCGTGATGCAT
AAATTTCTACGAGGTATGAAATCTTGTCGCGATGCATAATTTATGTGAGGTATGAAATCTTTTACAATGTATAATTTTCTGCGAGGTATGGAATCTTCTC
GCGATGCATAATTTCTGTGAGGTATGAAATCTTCTCACGATGCATAATTTTCTGCGAGGTATGAAATCTTCTCGCGATGCATAATTTTCTGCGAGGTATG
ATCTTCTCGCGATGCACAATTTACTGCGAGGCATAAAATCTTCCTGTGATGCAGAACTCTCGGCGAGGCATAAATATCTTCTCACGATGCATGAATATTC
ACTCGCAATGCATGGTCTTCCGCGATGCATGAGTATTGACTCGCAATGCATGGTCTTCCGCAATGCATGAGTATTGACTCGCGATGCATGATTTTTTGCG
ATGCACAAATACTGACTCGCGATGCATGATCTTCCGCGATGCATGAATCTCCACGATGCATGAATATCATATCGCCTCTAGTGATGATAACAGTAAAACG
ACTTCCAAATAGTATATCGTCTTGATCGATTGTAAAATATATGACCCCTCCGGGTAATGCGTAATATCATATCTGACATTATTGATGCAAATGAACTTCT
TTTTGGGAACCCTAAAACTCTTCCCTGACATTTTTTGCTTTGATTC
>LE_HBa0009H10_SP6_4194 (trimmed for quality and cloning vector)
TGATATTTCTTTTTATGTCAATGTAATCGTCATCTTTTTTACTTTAACTAACATAAAAGAATGCAGTTGATGCCAACGGATAAATATTTCTCTTCGGATT
CATGATTCTTTCTCCGGCAGTGCAAGATTTCTTACGGGACATGAATATCTTCCCGTGATGCATAAATTTCTACGAGGTATGAAATCTTGTCGCGATGCAT
AATTTATGTGAGGTATGAAATCTTTTACAATGTATAATTTTCTGCGAGGTATGGAATCTTCTCGCGATGCATAATTTCTGTGAGGTATGAAATCTTCTCA
CGATGCATAATTTTCTGCGAGGTATGAAATCTTCTCGCGATGCATAATTTTCTGCGAGGTATGATCTTCTCGCGATGCACAATTTACTGCGAGGCATAAA
ATCTTCCTGTGATGCAGAACTCTCGGCGAGGCATAAATATCTTCTCACGATGCATGAATATTCACTCGCAATGCATGGTCTTCCGCGATGCATGAGTATT
GACTCGCAATGCATGGTCTTCCGCAATGCATGAGTATTGACTCGCGATGCATGATTTTTTGCGATGCACAAATACTGACTCGCGATGCATGATCTTCCGC
GATGCATGAATCTCCACGATGCATGAATATCATATCGCCTCTAGTGATGATAACAGTAAAACGAC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.956902
Expected error %
0.142268
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009H10
Clone
Clone name
hba-9h10
LE_HBa0009H10
P009H10
Clone type
BAC
Contamination
none
Estimated length
126,873
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found