Clone Read LE_HBa0009H10_T7_4195

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009H10_T7_4195
Primer
T7
ID from Seq. Facility
LE_HBa_009_H10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
798 trimmed for vector and quality, 925 raw
Genbank Accession
Sequence
>LE_HBa0009H10_T7_4195 (raw untrimmed)
AACTGGGACCGAGGGGACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCTTGAATAGATTTCACCTTCCCCTTTGAATCCCTCAAGAGATCAGTACC
CCAAGGTCTAACCTCGAACGCATCAAACCAACCAATGGGGGAACTACATCTCCTACCATACAATGCTTTAAATGGAGCCATATCAATGCTTGAGTGATAG
CTATTATTGTATGAAAATTCCGCTAAGGGTAAGAAGCTATCCCAATGGCCTCCAAACTCTATCACACATGCGCGAGTCATATCCTCCAACACTTGAATTG
TTCTCTCAGACTGACCATCGGTCTGAGGATGGAACGCAGTACTAAGGTCCAACCTAGTACCCAATTCCGCATGCAGTGTTCTCCAAAACTTAGAAGTAAA
CTACGTACCTCTATCTGATATGATGGATAGTGGAACCCCATGCAACCGAACAATTTCTGAGATATAGATTTTGGCTAACTTCTCTGCATTTTAAGTCACC
TTGACTGGAATGAAATGAGCAGACTTAGTTAACCTATCAACAATCACCCAGATGGAATCGTACTTACCCATCGTCTTTGGAAGACCAACCACGAAGTCCA
TTGCGATTCTCTCCCATTTCCATTCAGGAATGGGCATCCTCTGAAGTGTTCCTCCGGGCCTTTGGTGTTCATACTTTACTTGTTGACAGTTTGGACATTT
GGCAATAAAGTCAACAATATTACGCTTCATTCTACTCCACCAAAAGTGTTGCTTTAGGTCACGGTACATCTTGGTTGCACCAGGATGTATAGAATACCTT
GAACTATGAGCCTCTGTCAGAATAGTGTTGATCAAATCGTCAACTCGGGGTACACATACCCCTTCCCTTGATTCCCAAAAAAACCTTCCCTCCATAAAAT
TTGTGCCTTCCTTTAACCCTCCCCC
>LE_HBa0009H10_T7_4195 (trimmed for quality and cloning vector)
AGCTTTTCTTGAATAGATTTCACCTTCCCCTTTGAATCCCTCAAGAGATCAGTACCCCAAGGTCTAACCTCGAACGCATCAAACCAACCAATGGGGGAAC
TACATCTCCTACCATACAATGCTTTAAATGGAGCCATATCAATGCTTGAGTGATAGCTATTATTGTATGAAAATTCCGCTAAGGGTAAGAAGCTATCCCA
ATGGCCTCCAAACTCTATCACACATGCGCGAGTCATATCCTCCAACACTTGAATTGTTCTCTCAGACTGACCATCGGTCTGAGGATGGAACGCAGTACTA
AGGTCCAACCTAGTACCCAATTCCGCATGCAGTGTTCTCCAAAACTTAGAAGTAAACTACGTACCTCTATCTGATATGATGGATAGTGGAACCCCATGCA
ACCGAACAATTTCTGAGATATAGATTTTGGCTAACTTCTCTGCATTTTAAGTCACCTTGACTGGAATGAAATGAGCAGACTTAGTTAACCTATCAACAAT
CACCCAGATGGAATCGTACTTACCCATCGTCTTTGGAAGACCAACCACGAAGTCCATTGCGATTCTCTCCCATTTCCATTCAGGAATGGGCATCCTCTGA
AGTGTTCCTCCGGGCCTTTGGTGTTCATACTTTACTTGTTGACAGTTTGGACATTTGGCAATAAAGTCAACAATATTACGCTTCATTCTACTCCACCAAA
AGTGTTGCTTTAGGTCACGGTACATCTTGGTTGCACCAGGATGTATAGAATACCTTGAACTATGAGCCTCTGTCAGAATAGTGTTGATCAAATCGTCA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.977452
Expected error %
0.405096
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 416 E Value 1e-115 Identity 24.10% Align. Length 791bp (99.12%) Frame 1
putative polyprotein, 3'-partial [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 412 E Value 1e-114 Identity 24.00% Align. Length 791bp (99.12%) Frame 1
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009H10
Clone
Clone name
hba-9h10
LE_HBa0009H10
P009H10
Clone type
BAC
Contamination
none
Estimated length
126,873
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found