Clone Read SL_FOS0109K17_pIBF_420015

Sequence Read 
Read Class
fosmid ends
Read ID
SL_FOS0109K17_pIBF_420015
Primer
pIBF
ID from Seq. Facility
not recorded
Chromatogram
not availabe for
direct download
Sequence 
Version
1 (current)
Length (bp)
340 trimmed for vector and quality, 1264 raw
Sequence
>SL_FOS0109K17_pIBF_420015 (raw untrimmed)
NNTTTTTTGAAAANNNNTTGAGCGNGCTGTCCGTCCGACGATGTAAACGACGGCCAGTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGT
ACCCGGGGATCCCACGAAATCTATTTTGCAACTTCAAACTAGTAAGTCAGGTTCCATAAATCCGTAGCCAGAAAAAGAAATTGTTTTTTTTTTTTTTTTG
TTTTTTCTGGAAAGTATTTTCTTATATTCAATTTTGTATTGGACAACAAAGGAATTCCTTTTGTGTATGCGCGCCTCAAAAAAGTATAGTACTCGATTCC
ATTACATGCATCGGGGGCAATCGAAAAAGCCAGCATTTCTTGGAATACTGACTATAATGCTACCAATAATTGTACTAATCCAACCGCATATGTCTTTCTC
CTACCAAAAGGAAAGAAAAAAGAAATAAGGATTTCCCCTTTGCTTTGACAATGGAATTCTTCCCCCGGTCCCCTTCAGAAAAAGGGAGAGATTTTTTGAT
ATATTTATTGGATCCGTCGGGACTGACGGGGCTCGAACCCGCAGCTTCCGCCTTGACAGGGCGGTGCTCTGACCAATTGAACTACAATCCCAGGGAAATA
CGGGATCTAGCAGAAAATTTGATTCTTTTTTATCTCCGGATCGGGTATTTCTGAAGTACAAAGGGAGTTATATCATCTCATGGCGGATTGGCGAATTATT
GGGCCGAGCTGGATTTGAACCAGCGTAGACATATTGCCAACGAATTTACAGTCCGTCCCCATTAACCGCTCGGGCATCGAC
CCAGGAAGAAATCATTTTT
CACTTATTTGGAATCCATGATCAATTTCTTTTCGTAGAACCCTACCCCCCCGGGGAAAATTTATACCCCCCCTGCTTCTTTGAAAGAGAAAAAGTTCTTA
TACCCCTAAACGAAGGGGGGGCCGCTTTGTCTNAAGGGCATTCTTAATTATGAATGGAAAAAAGAATCCCTTTTTTTTAAATTGTGCAAAATAAATAAAT
AGATTTTTAGTCGGAGGGATTTTTTTCCCTCCCTTTAAATGTTATAAAAATTTGTTTTTTTTTTTCCCTTAGCGCATTATATTGTTAGNATTAGCAATTA
GAATTCTGGAAGGAGATTTTTTTTTTTTATGATTGAGAAGAATATAATTTTTGTGTAAAATCTTTAAGAAATATAATAGATTTTTTTTTTATGATTCCAA
GTAATATAACTTTTTATTTTCTAATAAATCGTAATTATTTTAATAATTTTACGTTTAATATAGG
>SL_FOS0109K17_pIBF_420015 (trimmed for quality and cloning vector)
CCAGGAAGAAATCATTTTTCACTTATTTGGAATCCATGATCAATTTCTTTTCGTAGAACCCTACCCCCCCGGGGAAAATTTATACCCCCCCTGCTTCTTT
GAAAGAGAAAAAGTTCTTATACCCCTAAACGAAGGGGGGGCCGCTTTGTCTNAAGGGCATTCTTAATTATGAATGGAAAAAAGAATCCCTTTTTTTTAAA
TTGTGCAAAATAAATAAATAGATTTTTAGTCGGAGGGATTTTTTTCCCTCCCTTTAAATGTTATAAAAATTTGTTTTTTTTTTTCCCTTAGCGCATTATA
TTGTTAGNATTAGCAATTAGAATTCTGGAAGGAGATTTTT

This is probably not a useful sequence.

Problems:
  • High predicted error rate
  • Probable foreign DNA contamination
Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
20
Sequence entropy
0.914426
Expected error %
14.307
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone SL_FOS0109K17
Clone
Clone name
slf-109k17
SL_FOS0109K17
Clone type
Fosmid
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato Fosmid Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
  

Other Reads:
1 sequencing reads found