Clone Read LE_HBa0009I12_SP6_4246

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009I12_SP6_4246
Primer
SP6
ID from Seq. Facility
LE_HBa_009_I12-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
652 trimmed for vector and quality, 889 raw
Genbank Accession
Sequence
>LE_HBa0009I12_SP6_4246 (raw untrimmed)
CTAATAACGGATGGGAACACCCTTTTAGAGGTGAGCTGTGTCGATGAGCCTGCATCATGATGAAGCCTTGACTCACCTCTGCTATTTTGGTCGTCGTTAG
TATCCAAGGTTTTTTCTCCAACTTTTCAACTGCTACACTAACTCTATTGTTGTCATAGTTATTCAAGTTATTCTATTTCAAAGTACGCGATAACTTGGAA
TTGTTTTAGTATTTTTAATGTTCTTTCTATTGCCTTTGCATTCTATGAAATTCTATGGTTTTTCCTTGCAATTGAATTTGTTGAGTCACAACAGAAGAAA
ATGTAACAAACACTTGATGAAACAAAACACAACCACTAACTATGAAAGTAAAAACTTTTATTCACATCCCAGCAATGCAGTAGGCTTGAATCCTGCAGTT
TTAAAAAAATGAAAGTATTAAAGTTGAAAGCTTTAAGGATGAAATTTTATGGATATATAAAATGTGATCTTCTGAAGGATAGAGATTAAGTTGAATACCT
GGAGGTTACATGCTAATATCTTTTCTTGTGCTTTTTCATTCTTGTAATAATTATGTGTTCCAATTTTACATCCATCCTCGAAAACCATGCTGGATATTGA
GTTGACAACATTATGTATATTATGGACAATCCAATAACAAGTCCACAACCGTAACCCATGAGAACCGCCTGCCAACTGATCATTGGTGAATTTTCTTCTT
CTTCTTCTTCATCATCTAGCTCAAATGGAGTTGTTGCTTCTGGTACCCCTTCATCGCCCCCACAATCTTTTTGAAAGTGGAAATCCAAGGTACCCCATCA
TTCCCTTGGTAATGAACATTCTCAAACGTATCAAATTGGTTTTCCTCGGGGGGAAGCATCCCACAAAAATGAATGGTAAAAAAAATTTT
>LE_HBa0009I12_SP6_4246 (trimmed for quality and cloning vector)
CTGTGTCGATGAGCCTGCATCATGATGAAGCCTTGACTCACCTCTGCTATTTTGGTCGTCGTTAGTATCCAAGGTTTTTTCTCCAACTTTTCAACTGCTA
CACTAACTCTATTGTTGTCATAGTTATTCAAGTTATTCTATTTCAAAGTACGCGATAACTTGGAATTGTTTTAGTATTTTTAATGTTCTTTCTATTGCCT
TTGCATTCTATGAAATTCTATGGTTTTTCCTTGCAATTGAATTTGTTGAGTCACAACAGAAGAAAATGTAACAAACACTTGATGAAACAAAACACAACCA
CTAACTATGAAAGTAAAAACTTTTATTCACATCCCAGCAATGCAGTAGGCTTGAATCCTGCAGTTTTAAAAAAATGAAAGTATTAAAGTTGAAAGCTTTA
AGGATGAAATTTTATGGATATATAAAATGTGATCTTCTGAAGGATAGAGATTAAGTTGAATACCTGGAGGTTACATGCTAATATCTTTTCTTGTGCTTTT
TCATTCTTGTAATAATTATGTGTTCCAATTTTACATCCATCCTCGAAAACCATGCTGGATATTGAGTTGACAACATTATGTATATTATGGACAATCCAAT
AACAAGTCCACAACCGTAACCCATGAGAACCGCCTGCCAACTGATCATTGGT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.951906
Expected error %
0.100915
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAV41396.1| Score 112 E Value 8e-24 Identity 29.80% Align. Length 170bp (26.07%) Frame 2
peru 2 [Lycopersicon peruvianum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA05279.1| Score 112 E Value 8e-24 Identity 29.80% Align. Length 170bp (26.07%) Frame 2
Hcr9-0 [Lycopersicon esculentum] pir||T07039 Hcr9-0 protein - tomato
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009I12
Clone
Clone name
hba-9i12
LE_HBa0009I12
C01HBa0009I12
P009I12
Clone type
BAC
Contamination
none
Estimated length
148,110
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found