Clone Read LE_HBa0121O22_SP6_42570

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0121O22_SP6_42570
Primer
SP6
ID from Seq. Facility
LE_HBa_121_O22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
684 trimmed for vector and quality, 795 raw
Genbank Accession
Sequence
>LE_HBa0121O22_SP6_42570 (raw untrimmed)
CCAGGATTCTTTCTNTNACTTGTACTTCCCTTCAAAGTTTGAAGAGGGGTCCATATAGACTTCTTCCTCTAGGTACTTTTTAAGAAAGCATTCTTCACAT
CCAACTATTGAAGAGACCTGTCAAGATTTACTACGATTGTCAACTAAACTCTAATTGAGTTTAGCATAGCTACTGGAGCAAACTTCTCAAGATAGTCAAT
GACATATGTTTGCGTGAATCCCTTAGCTACTAGGCAAGCCTTATACCTTGCTAAGGATCTATTCGATTTGAATTTGGTGGTGAACACCCATTTACAACCA
CGAACTCCCACGTCTTTTTTTTTTCAAGAGCTCAAAATTCCTCCAAAATAGCCTCCTTATGGCTTCCACTCGGGAACTCGTAGGGCATCCTGCACATTTT
TTGGAATCTCCACACTAGAAAGTTGTGAAGTAAGGGCTGAATAACTAGGAGACAACTTTTTATTGGACAATAACATAGAAACAAAATAATTAGGAGCATT
TCTAACACCTTGTGTTTTTCTATAGGTTGGTCCAGATCTGAGGAGTTAGAAATAGAATTGATTGGAAGATTACCTGAATACCAATAAGGTCTTGCGGAAC
TGACTTTTGGTAGTGTTGAAAATCTCCAATCTTTTTTCCTTGAGTTCAGTTCCTTTTCGAGTACACCTATATTTCTTTTGTTGTTCTTTATTCCCCATTT
TTATTTTTCATTTGAAGGCTCTACAAGTTCAATTTATGATTTCTTATCATTTAAGTGACTTAGGTCCCAACCCTCTCTTGGATCACACTTATTTA
>LE_HBa0121O22_SP6_42570 (trimmed for quality and cloning vector)
TTGTACTTCCCTTCAAAGTTTGAAGAGGGGTCCATATAGACTTCTTCCTCTAGGTACTTTTTAAGAAAGCATTCTTCACATCCAACTATTGAAGAGACCT
GTCAAGATTTACTACGATTGTCAACTAAACTCTAATTGAGTTTAGCATAGCTACTGGAGCAAACTTCTCAAGATAGTCAATGACATATGTTTGCGTGAAT
CCCTTAGCTACTAGGCAAGCCTTATACCTTGCTAAGGATCTATTCGATTTGAATTTGGTGGTGAACACCCATTTACAACCACGAACTCCCACGTCTTTTT
TTTTTCAAGAGCTCAAAATTCCTCCAAAATAGCCTCCTTATGGCTTCCACTCGGGAACTCGTAGGGCATCCTGCACATTTTTTGGAATCTCCACACTAGA
AAGTTGTGAAGTAAGGGCTGAATAACTAGGAGACAACTTTTTATTGGACAATAACATAGAAACAAAATAATTAGGAGCATTTCTAACACCTTGTGTTTTT
CTATAGGTTGGTCCAGATCTGAGGAGTTAGAAATAGAATTGATTGGAAGATTACCTGAATACCAATAAGGTCTTGCGGAACTGACTTTTGGTAGTGTTGA
AAATCTCCAATCTTTTTTCCTTGAGTTCAGTTCCTTTTCGAGTACACCTATATTTCTTTTGTTGTTCTTTATTCCCCATTTTTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.959416
Expected error %
0.117099
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g23160.1 Score 74 E Value 6e-14 Identity 11.40% Align. Length 401bp (58.63%) Frame 3
68417.m03342 protein kinase family protein contains Pfam domain PF00069: Protein kinase domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAA36615.1| Score 149 E Value 8e-35 Identity 17.60% Align. Length 590bp (86.26%) Frame 3
unnamed protein product [Solanum tuberosum] pir||S25786 hypothetical protein 3 - potato transposon Tst1
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU10804.1| Score 96 E Value 2e-19 Identity 44.00% Align. Length 457bp (66.81%) Frame 1
unknown protein [Oryza sativa (japonica cultivar-group)]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0121O22
Clone
Clone name
hba-121o22
LE_HBa0121O22
C07HBa0121O22
P121O22
Clone type
BAC
Contamination
none
Estimated length
124,194
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found