Clone Read LE_HBa0121O22_T7_42571

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0121O22_T7_42571
Primer
T7
ID from Seq. Facility
LE_HBa_121_O22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
708 trimmed for vector and quality, 795 raw
Genbank Accession
Sequence
>LE_HBa0121O22_T7_42571 (raw untrimmed)
CCTGGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAAGCTTTTCGGGTTTCCCGACATTGAAGGTTCACTCTGTTCTAATAATG
TAAGTTTTCATATCCTTATTTCAGTTAAACTTCCCATATATGTAAATTATGTGTGTTTAATTTTTGCTGAGTTCATGTAAATATATGAATATTATCATGA
ATCTATTTTAATTTTTGAATATTATCATGAATCTATTTTACCTAGCATATGGTTAGTCTCTTAGCCTCTTAAAAGTATCGATGGATTAACCTGTAAATTC
CTAGGACGAGTCAGGTTAAATGTTCTAAGAAAAGAACTGTGAATAACCAATTCCGAGGTGGGGTTAAAGAAGATTACTCTTAAGAACAAAGGCTAAGGGA
AAGAGATGAACAGTATTAATAGATTCATGAATGGACAGAATCCATAAAAAAAATAAAGGAAGTTTAAACTAGAAACTAAATATGATAAATACATAATAGA
ACAAGAGAGAGTGAAGGAGTACTGAGTAGGACTGTACAACATTAAGAAAAATCACCATTTTTTTTTGAAATATTACCTTTATTTGAAATATCACCTTATT
ATATATATATATATATATGTATATATATATATATATGTATGTATGTATATATGTATGTATCCATGTATGCATGTATATATATTATTTTTTTTATGTTTAA
AAAAGTGTATAAAAATTGATATCAATTAGTAAAATTTTATTTGTATATATAAACCATTTTACTATATGTAAAAGGTATAACATTTTATATTCATA
>LE_HBa0121O22_T7_42571 (trimmed for quality and cloning vector)
AGCTTGGAAGCTTTTCGGGTTTCCCGACATTGAAGGTTCACTCTGTTCTAATAATGTAAGTTTTCATATCCTTATTTCAGTTAAACTTCCCATATATGTA
AATTATGTGTGTTTAATTTTTGCTGAGTTCATGTAAATATATGAATATTATCATGAATCTATTTTAATTTTTGAATATTATCATGAATCTATTTTACCTA
GCATATGGTTAGTCTCTTAGCCTCTTAAAAGTATCGATGGATTAACCTGTAAATTCCTAGGACGAGTCAGGTTAAATGTTCTAAGAAAAGAACTGTGAAT
AACCAATTCCGAGGTGGGGTTAAAGAAGATTACTCTTAAGAACAAAGGCTAAGGGAAAGAGATGAACAGTATTAATAGATTCATGAATGGACAGAATCCA
TAAAAAAAATAAAGGAAGTTTAAACTAGAAACTAAATATGATAAATACATAATAGAACAAGAGAGAGTGAAGGAGTACTGAGTAGGACTGTACAACATTA
AGAAAAATCACCATTTTTTTTTGAAATATTACCTTTATTTGAAATATCACCTTATTATATATATATATATATATGTATATATATATATATATGTATGTAT
GTATATATGTATGTATCCATGTATGCATGTATATATATTATTTTTTTTATGTTTAAAAAAGTGTATAAAAATTGATATCAATTAGTAAAATTTTATTTGT
ATATATAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.886493
Expected error %
0.698776
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0121O22
Clone
Clone name
hba-121o22
LE_HBa0121O22
C07HBa0121O22
P121O22
Clone type
BAC
Contamination
none
Estimated length
124,194
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found