Clone Read LE_HBa0041B05_SP6_42680

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041B05_SP6_42680
Primer
SP6
ID from Seq. Facility
LE_HBa_041_B05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
651 trimmed for vector and quality, 813 raw
Genbank Accession
Sequence
>LE_HBa0041B05_SP6_42680 (raw untrimmed)
AAATTTTCCTTTTTAGCCTTGGGGCCAGTAGAGGGTAAGAACTTCATCGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGCAAGAGA
AGAGTGTGATTGCTTATGCTTCAAGGCAATTAAAGGGGCATGAACATAATTATCCAACTCATGATTTGGAATTGGCTGCGGTAGTATTTGCATTAAAACA
ATGGAGACACTATTTATATGGGGTTAAGTGTGAGGTCTATACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAGGATTTGAACTTGAGACAGAGG
AGATGGATGGAACTACTGAAGGACTACGACATCACTATTTTGTATCATCCGGGGAAGGCGAATGTTGTGGCGGATGCTTTAAGTAGAAAGGCGGGAAGCA
TGGGAAGTCTAGCTCACTTGCAAGCTTCTAGACGTCCTTTGGATAGAGAGGTTCAGACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATGAGAAGGG
AGGATTGTTGGCTTCTGTGGAGTCAACATCTTCTTTTCTTGACAAAATTAAGGGAAAACAGTTTGATGATGAGAAACTAAGAAGAATCCAAGATAAGGTA
TTGCGAGGAGAGGCTAAGGAAGCACAAATCGATGAGGAAGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACCCCGCGTCGATGGATTTGATCAACACT
ATTCTGACAAAGGCTCATAGTTCAAGGTATTCTATACATCCGGGTGCAACCAAAGATGTATCGGGACCTAAAACAACCCTTTTTGGGGGAATAAAAATGA
AATCCTGACATTG
>LE_HBa0041B05_SP6_42680 (trimmed for quality and cloning vector)
GTAGAGGGTAAGAACTTCATCGTTTATTGTGATGCATCCTATTCTGGTTTGGGTGCAGTACTAATGCAAGAGAAGAGTGTGATTGCTTATGCTTCAAGGC
AATTAAAGGGGCATGAACATAATTATCCAACTCATGATTTGGAATTGGCTGCGGTAGTATTTGCATTAAAACAATGGAGACACTATTTATATGGGGTTAA
GTGTGAGGTCTATACGGATCATCGTAGCCTTCAGTATGTCTTTACTCAGAAGGATTTGAACTTGAGACAGAGGAGATGGATGGAACTACTGAAGGACTAC
GACATCACTATTTTGTATCATCCGGGGAAGGCGAATGTTGTGGCGGATGCTTTAAGTAGAAAGGCGGGAAGCATGGGAAGTCTAGCTCACTTGCAAGCTT
CTAGACGTCCTTTGGATAGAGAGGTTCAGACTCTAGCTAATGACTTGATGAGATTAGAAGTAAATGAGAAGGGAGGATTGTTGGCTTCTGTGGAGTCAAC
ATCTTCTTTTCTTGACAAAATTAAGGGAAAACAGTTTGATGATGAGAAACTAAGAAGAATCCAAGATAAGGTATTGCGAGGAGAGGCTAAGGAAGCACAA
ATCGATGAGGAAGGTGTTTTGAGAATCAAGGGAAGGGTATGTGTACCCCGC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962722
Expected error %
0.160587
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT66771.1| Score 298 E Value 1e-79 Identity 22.00% Align. Length 650bp (99.85%) Frame 2
putative polyprotein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38745.1| Score 296 E Value 3e-79 Identity 22.10% Align. Length 650bp (99.85%) Frame 2
putative polyprotein, 3'-partial [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041B05
Clone
Clone name
hba-41b5
LE_HBa0041B05
C03HBa0041B05
P041B05
Clone type
BAC
Contamination
none
Estimated length
94,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found