Clone Read LE_HBa0041B05_T7_42681

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041B05_T7_42681
Primer
T7
ID from Seq. Facility
LE_HBa_041_B05-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
454 trimmed for vector and quality, 857 raw
Genbank Accession
Sequence
>LE_HBa0041B05_T7_42681 (raw untrimmed)
TTTTAACTGGTCCCGGGGGGATCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAGGCAAAGAGGGGCAAGCATTAGAAAGTAGTTGCTAAGTATTGATT
TAATGTTTTTTTTCGTATGTAATGGCACAGTGGAACTTCTTAAACTGCTATTTTGGAGGGGAAAGAATTAAAAATTTGTTTGATAATGTTTTGTGGGCTG
AAAATATTTTGTGACTTGAAAATTTTATAAATGCATTCTATTATTCGGTGGTTTCCTGGAACTGTTGAAACTTTGTGGTTGTGGAACTGTTGCAGTTTCG
TGGTCTGTGGAACTGATGAGCAGACCATAGTAATTTTTTTAGAGATGCTTCACTCAATTGTTTTCTTTTCAGGTCCAACATTGAGTTGGAAACACTCGTT
GAGTTGGAAATGTATTGAGATAATGAGTTAGTTGTATGGAGGTTGTTGTTTAGTGTACATTAAAATATGATTAACTGCAATGGACAGTGGCTGAAAAGGA
AGCACCAACACTCCTTTTTTCGCTTCTCCAATACTTGAGTTGATTGTGTTTCTAACCTCCATAGCTATACTCTCCATCCATGGAGCCGAACAGGCCCACT
TCTCCACTTTGTAGCCTTCCCTTACTCTTCATTTTTCAGACGTCTTCTTTTTTTCCTTACTTCCTTTCTCTCTGTGTTTATTCTTTTTCCCTATTTTCAC
TTATAAGTTTTAAATTCTCCATTCGATTTTATAGTTCCTCCATTTCATACTCTCCTCCTCTTACTACATGTTTTGTGCTCTTTTGTCTTTTTTCTTTCTT
CCCTTTTATTCTCTTCCTCCTTCTCCTCCTTCTTTCTTACTTCAATTCTGCCTTTCG
>LE_HBa0041B05_T7_42681 (trimmed for quality and cloning vector)
AGCTTAAGGCAAAGAGGGGCAAGCATTAGAAAGTAGTTGCTAAGTATTGATTTAATGTTTTTTTTCGTATGTAATGGCACAGTGGAACTTCTTAAACTGC
TATTTTGGAGGGGAAAGAATTAAAAATTTGTTTGATAATGTTTTGTGGGCTGAAAATATTTTGTGACTTGAAAATTTTATAAATGCATTCTATTATTCGG
TGGTTTCCTGGAACTGTTGAAACTTTGTGGTTGTGGAACTGTTGCAGTTTCGTGGTCTGTGGAACTGATGAGCAGACCATAGTAATTTTTTTAGAGATGC
TTCACTCAATTGTTTTCTTTTCAGGTCCAACATTGAGTTGGAAACACTCGTTGAGTTGGAAATGTATTGAGATAATGAGTTAGTTGTATGGAGGTTGTTG
TTTAGTGTACATTAAAATATGATTAACTGCAATGGACAGTGGCTGAAAAGGAAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.922344
Expected error %
0.578836
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041B05
Clone
Clone name
hba-41b5
LE_HBa0041B05
C03HBa0041B05
P041B05
Clone type
BAC
Contamination
none
Estimated length
94,529
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found