Clone Read LE_HBa0041E11_SP6_42836

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041E11_SP6_42836
Primer
SP6
ID from Seq. Facility
LE_HBa_041_E11-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
620 trimmed for vector and quality, 858 raw
Genbank Accession
Sequence
>LE_HBa0041E11_SP6_42836 (raw untrimmed)
GTTTTTTGGGAAACGTTCATATCTCGGTAAACACCATCATCTATATAACTTTTAGTTTTTACCCTCAACAATATACTCTTATAACCATGGATGCATATCG
ACATGTTTAATTTCACAAACTTCTAAGGATACTTCTAATATGCACGAAAAAATATGATTAAAACTCATCATTTGATCAAATCACTGTCATATAAAATGAA
ACGGACGTAACAAATTTATATAAAAATTATGGTTTAGTAAATTCCTAATTTTTACCTTATCTTTTTTTTCCTTCTACTCTTATAAACTTGCAATTTTTGG
TAGGCAAATCACTCTGTTAGCAAAGTTGAAGATGCAATTCAAAGAGCTTGTGAATCAGCTCATCAAAAAAGGGAACATAATTCTGGATTTCTTCACCAGG
TAATTTTATTAGATATCATTGAATAGTCGAAGTGTGCGTAAACTACTCTCGAAATCGCGATTACAAAAAAAATCAAAATATATTTTTGGTGTATTAAATT
ATTTTTCTTGTTGATTGTATTTTAGACTGGAGAGCAAATGTTGCACATGGCTCAAGATGCAGTTGATGGGGTGAAGAACACATTTGGAATTGGAACTAAA
AATAATAAATAAAAAAATTATTGTTCACTAAATATGTTATATAAAGGATTTGAACCCAATAAGAATTATCTATCACTATTGTTTATATTAATCATATAAA
CATGTCACAATTTATTTTTGGTTGGTGTTTGTTTTGCGCATTAAGATTTTTTTATAAAATGAACCCAAAAATTAAGAGAAAAAAAATAGGCCAAAATATT
TTCCTTTTTCAATATCAATTGGGAAAGGCTACTTTCCAAAAGTTTGGAGAATTTTCGA
>LE_HBa0041E11_SP6_42836 (trimmed for quality and cloning vector)
AAACACCATCATCTATATAACTTTTAGTTTTTACCCTCAACAATATACTCTTATAACCATGGATGCATATCGACATGTTTAATTTCACAAACTTCTAAGG
ATACTTCTAATATGCACGAAAAAATATGATTAAAACTCATCATTTGATCAAATCACTGTCATATAAAATGAAACGGACGTAACAAATTTATATAAAAATT
ATGGTTTAGTAAATTCCTAATTTTTACCTTATCTTTTTTTTCCTTCTACTCTTATAAACTTGCAATTTTTGGTAGGCAAATCACTCTGTTAGCAAAGTTG
AAGATGCAATTCAAAGAGCTTGTGAATCAGCTCATCAAAAAAGGGAACATAATTCTGGATTTCTTCACCAGGTAATTTTATTAGATATCATTGAATAGTC
GAAGTGTGCGTAAACTACTCTCGAAATCGCGATTACAAAAAAAATCAAAATATATTTTTGGTGTATTAAATTATTTTTCTTGTTGATTGTATTTTAGACT
GGAGAGCAAATGTTGCACATGGCTCAAGATGCAGTTGATGGGGTGAAGAACACATTTGGAATTGGAACTAAAAATAATAAATAAAAAAATTATTGTTCAC
TAAATATGTTATATAAAGGA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.915896
Expected error %
0.461647
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041E11
Clone
Clone name
hba-41e11
LE_HBa0041E11
C12HBa0041E11
P041E11
Clone type
BAC
Contamination
none
Estimated length
89,275
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found