Clone Read LE_HBa0041E11_T7_42837

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041E11_T7_42837
Primer
T7
ID from Seq. Facility
LE_HBa_041_E11-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
672 trimmed for vector and quality, 935 raw
Genbank Accession
Sequence
>LE_HBa0041E11_T7_42837 (raw untrimmed)
TTACCCTGGGTACCGGGTGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCACCCTGCAAATGGGGACTTCCTCTTCGTTTGCTATCACCGAATT
CAACGAGAGAAATACATCTGCGTGAAGCATAGATTTGAGTGGTTTTATAGTGAGGAAATTTCAAAAGATGGCATTTCTTTTGAATGTATTAGCATCAAGA
ACTTTGTGACACTCAAGTGTGTAGAGTGCATCTAATCTCACCGTAGTGATTGTTTTGCTCTTCTTGGGACGTGGTTTTCCCCCTAGTTTAGATCTTCCAC
GCAAAAGTATTGGTGCCCTTATATCCCCATTATCTTAAATGTGAATATTTCTGTTGGCATTCTGTGATCCCCAACAATACCTCCCGATTTTCCATCTTTA
TGTTTTGACATTACTTGTTTATCTATTGTATATTTTTGCAGAAGTGTACAGAACGACAGTTTCCTCCTGCTGATGTGGCAAAAGTACTTGATTCCGCTGT
AGCAAGCTTGCAACCAAGTTGCTCGCAGAACACTCCAATCTACCGTGAAATACAGAAGTGCATGGGAATCATCAGAAACCAAATTCTGTCATTGGTACCA
ACGTAGACCATGTGTAAGTTGCACGGACTCTTCACTTTCGATGCCGTACCCGTATCGGATTCTCTAAAAAAGTACACTACATTTGGAGAACCTGCCACAC
ACCCGTTGACATTTTTGAAAGTCCGAGCACCATGGTTATCCCCTCTAGTCTTTTTTCATCCTTGTAAACCTCGTATGCAGATAAACACCCTACTCCATCG
CTCCCCCCCTAGACCCAATTCCAACTTCAATTTACTGTCCCCATCGGTGATTTCCGTCTCTTCGGTCCCCCCTCCTATGGAATAGGGGATTGTTAAAAAA
CACGGTCTTGGAATCCTTTGAGGAGTGCAACGCAA
>LE_HBa0041E11_T7_42837 (trimmed for quality and cloning vector)
AGCTTTCACCCTGCAAATGGGGACTTCCTCTTCGTTTGCTATCACCGAATTCAACGAGAGAAATACATCTGCGTGAAGCATAGATTTGAGTGGTTTTATA
GTGAGGAAATTTCAAAAGATGGCATTTCTTTTGAATGTATTAGCATCAAGAACTTTGTGACACTCAAGTGTGTAGAGTGCATCTAATCTCACCGTAGTGA
TTGTTTTGCTCTTCTTGGGACGTGGTTTTCCCCCTAGTTTAGATCTTCCACGCAAAAGTATTGGTGCCCTTATATCCCCATTATCTTAAATGTGAATATT
TCTGTTGGCATTCTGTGATCCCCAACAATACCTCCCGATTTTCCATCTTTATGTTTTGACATTACTTGTTTATCTATTGTATATTTTTGCAGAAGTGTAC
AGAACGACAGTTTCCTCCTGCTGATGTGGCAAAAGTACTTGATTCCGCTGTAGCAAGCTTGCAACCAAGTTGCTCGCAGAACACTCCAATCTACCGTGAA
ATACAGAAGTGCATGGGAATCATCAGAAACCAAATTCTGTCATTGGTACCAACGTAGACCATGTGTAAGTTGCACGGACTCTTCACTTTCGATGCCGTAC
CCGTATCGGATTCTCTAAAAAAGTACACTACATTTGGAGAACCTGCCACACACCCGTTGACATTTTTGAAAG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978644
Expected error %
0.59628
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g21430.1 Score 101 E Value 3e-22 Identity 27.00% Align. Length 173bp (25.74%) Frame 1
68416.m02704 expressed protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At3g05380.1 Score 90 E Value 1e-18 Identity 23.00% Align. Length 173bp (25.74%) Frame 1
68416.m00588 myb family transcription factor contains Pfam profile:PF00249 Myb-like DNA-binding domain
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAB03056.1| Score 101 E Value 1e-20 Identity 27.00% Align. Length 173bp (25.74%) Frame 1
unnamed protein product [Arabidopsis thaliana]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
emb|CAE47462.1| Score 101 E Value 1e-20 Identity 27.00% Align. Length 173bp (25.74%) Frame 1
always early protein 3 [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041E11
Clone
Clone name
hba-41e11
LE_HBa0041E11
C12HBa0041E11
P041E11
Clone type
BAC
Contamination
none
Estimated length
89,275
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found