Clone Read LE_HBa0041I09_SP6_43024

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041I09_SP6_43024
Primer
SP6
ID from Seq. Facility
LE_HBa_041_I09-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
561 trimmed for vector and quality, 869 raw
Genbank Accession
Sequence
>LE_HBa0041I09_SP6_43024 (raw untrimmed)
TTCCAAAAAAATCTTCATGACATGCATTGGATNGCAGCCTTTTTGTTCCAACTCTTCTATTTTCTTACAAATCTCCAATCCCTTTGTTTCTGGCAGAAAA
ACAACCAAACACCCTGCAATTGCTGTTATAATGCCAAGAACCAAATAAGCTAGAATCTTGTTGTTACTATCCCCTCCTGCATCAACCAAAACCGGGCTCA
CCACGCCCCCGAGGACCACAGCCTGCCATACAATTGACACTGCTGCATTCCTTATACTAGTATGGAACAGCTCTGAAGTATATATCAGCAACAGATCAAA
TGCAGTACAAGCACTGAAAAATGAAGTAAACTCCAACACCATCTGTAAAACCTTTCGTTCACTCACGATCATACATAACATACCACAAACACCAGATACA
ACACTTAGTCCAACTAATGTACTTCTCCTCTTACATTTTTCAGCCAAGAAAAACACTATCAAGAATGATGGTAACTCTAGTAACGCGTTTAGTCCTGTAC
TCAAGTAGAGATTTAAGCTAAAGTTTCCATTTCCTAGTCCTAATGGCATCCCATAGTACATCAATCCAATGCCAAAACCAGCTACTACAGCTAGTAATAA
CTGTCCAAGAATCGATTTTTTCCTCAACAAATTCTTGATCAGAGGTGGATCAGAACCTCTCATGGTAGTAAAACCTCACTTGTTATGAACAAGATTCCAT
CTTTCCGTTCCTTGTAAATGGGAATGTGTTGAAAAATTGCATTAAGCCTCTATTACCTTTCCCTTTTTGAAAAAAACCCATTTTTGGAAAAATTCCATAA
AACACAAAAACTGTTATCCAACAAACCAAGTAAAAACCTATAGCCTGGGCAAAAAAAATTTTCCGAAAA
>LE_HBa0041I09_SP6_43024 (trimmed for quality and cloning vector)
AGCCTTTTTGTTCCAACTCTTCTATTTTCTTACAAATCTCCAATCCCTTTGTTTCTGGCAGAAAAACAACCAAACACCCTGCAATTGCTGTTATAATGCC
AAGAACCAAATAAGCTAGAATCTTGTTGTTACTATCCCCTCCTGCATCAACCAAAACCGGGCTCACCACGCCCCCGAGGACCACAGCCTGCCATACAATT
GACACTGCTGCATTCCTTATACTAGTATGGAACAGCTCTGAAGTATATATCAGCAACAGATCAAATGCAGTACAAGCACTGAAAAATGAAGTAAACTCCA
ACACCATCTGTAAAACCTTTCGTTCACTCACGATCATACATAACATACCACAAACACCAGATACAACACTTAGTCCAACTAATGTACTTCTCCTCTTACA
TTTTTCAGCCAAGAAAAACACTATCAAGAATGATGGTAACTCTAGTAACGCGTTTAGTCCTGTACTCAAGTAGAGATTTAAGCTAAAGTTTCCATTTCCT
AGTCCTAATGGCATCCCATAGTACATCAATCCAATGCCAAAACCAGCTACTACAGCTAGTA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.952695
Expected error %
0.113968
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g16390.1 Score 101 E Value 2e-22 Identity 13.30% Align. Length 449bp (80.04%) Frame 3
68414.m01960 organic cation transporter-related low similarity to Organic cation/carnitine transporter 2 (Solute carrier family 22, member 5) (High-affinity sodium-dependent carnitine cotransporter) from {Homo sapiens} SP|O76082, {Rattus norvegicus} SP|O70594; contains Pfam profile PF00083: major facilitator superfamily protein
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g79360.1 Score 89 E Value 1e-18 Identity 11.70% Align. Length 461bp (82.17%) Frame 3
68414.m09248 transporter-related low similarity to SP|O76082 Organic cation/carnitine transporter 2 (Solute carrier family 22, member 5) (High-affinity sodium-dependent carnitine cotransporter) {Homo sapiens}; contains Pfam profile PF00083: major facilitator superfamily protein
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAN38700.1| Score 101 E Value 1e-20 Identity 13.30% Align. Length 449bp (80.04%) Frame 3
At1g16390/F3O9_19 [Arabidopsis thaliana] gb|AAL79578.1| At1g16390/F3O9_19 [Arabidopsis thaliana] ref|NP_173089.1| organic cation transporter-related [Arabidopsis thaliana] gb|AAD34691.1| Is a member of the PF|00083 sugar transporter family. [Arabidopsis thaliana] pir||B86299 hypothetical protein F3O9.19 - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_178054.1| Score 89 E Value 5e-17 Identity 11.70% Align. Length 461bp (82.17%) Frame 3
transporter-related [Arabidopsis thaliana] gb|AAC17057.1| Similar to liver-specific transport protein gb|L27651 from Rattus norviegicus. [Arabidopsis thaliana] pir||T01019 transport protein homolog YUP8H12R.2 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041I09
Clone
Clone name
hba-41i9
LE_HBa0041I09
C08HBa0041I09
P041I09
Clone type
BAC
Contamination
none
Estimated length
85,337
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found