Clone Read LE_HBa0041K06_T7_43115

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041K06_T7_43115
Primer
T7
ID from Seq. Facility
LE_HBa_041_K06-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
680 trimmed for vector and quality, 903 raw
Genbank Accession
Sequence
>LE_HBa0041K06_T7_43115 (raw untrimmed)
CATGACTTTGGACTCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGGAGTACTAGGAAGTCAGATACTGGGAGAAATACCTTCGCAGTGCA
ATCCACTCACAACCCAGCCACAAATGAGATTCGTGAAAAGATGGCTCAGATGAGAACTGAGCTTAGGTTGGTGTTAAAACATATCACTGGGATGCAGAAA
AGATAAATGCAGTCAACTACTTATCTAAACCACCACCACCAAATGATGAATGCTATTACGAGGAGAATTCCTAGGCGGTAAATGAGCAGACGGGGGGTTT
CCGACCGAGTGCCCAAGGCTCAAATCAGGAGAATTGGCGCCAAGGTCAAGGAAACCAAGGTCGGATCTATGGTAATTATAATCGTGAGGGTCATTATGTG
CGATATGGAAAATAAAACAGTGAAAACAGCTTCAACAGGGGTAACTATGGTAACAGAAATGATAGGAATGGGCCCTATGTCCCTCCTCAAAATCGTGAAG
TTATTAGTAGGGATGGTGGAGATAGTACGGCGCGAGTTGAGGATATGTTGCACAAAATTATGAGGAGGTTTGATTCTAATGATAAGCACATCAAAGAATT
AAGGAGTTATTTAGCGGGTAATGGGAAGAAAGTCGATCCCCATGTCATTTCGATTAAGCAGATTGAGTTTGCAAATGGCTGAATTATCTGCGACTGTGAA
CACACTTCTACCGGGCACTCTTCCTAAAAAGACTGTCAACATCCAACATATGACGACAATGTATGTGAATCTCTTCTCTGGGTTGTAATCGACCCTTTTA
CCCCCTCGCCCTCTTAAGAGGAAAATACGATAATGTACCGATTATGCGCTATTGGTATTGTTCACATCTAACATCCTACCAAACAATCCTCACTTCCCCT
ACC
>LE_HBa0041K06_T7_43115 (trimmed for quality and cloning vector)
AGCTTGGAGTACTAGGAAGTCAGATACTGGGAGAAATACCTTCGCAGTGCAATCCACTCACAACCCAGCCACAAATGAGATTCGTGAAAAGATGGCTCAG
ATGAGAACTGAGCTTAGGTTGGTGTTAAAACATATCACTGGGATGCAGAAAAGATAAATGCAGTCAACTACTTATCTAAACCACCACCACCAAATGATGA
ATGCTATTACGAGGAGAATTCCTAGGCGGTAAATGAGCAGACGGGGGGTTTCCGACCGAGTGCCCAAGGCTCAAATCAGGAGAATTGGCGCCAAGGTCAA
GGAAACCAAGGTCGGATCTATGGTAATTATAATCGTGAGGGTCATTATGTGCGATATGGAAAATAAAACAGTGAAAACAGCTTCAACAGGGGTAACTATG
GTAACAGAAATGATAGGAATGGGCCCTATGTCCCTCCTCAAAATCGTGAAGTTATTAGTAGGGATGGTGGAGATAGTACGGCGCGAGTTGAGGATATGTT
GCACAAAATTATGAGGAGGTTTGATTCTAATGATAAGCACATCAAAGAATTAAGGAGTTATTTAGCGGGTAATGGGAAGAAAGTCGATCCCCATGTCATT
TCGATTAAGCAGATTGAGTTTGCAAATGGCTGAATTATCTGCGACTGTGAACACACTTCTACCGGGCACTCTTCCTAAAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.978109
Expected error %
1.19751
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38730.1| Score 127 E Value 3e-34 Identity 40.60% Align. Length 616bp (90.59%) Frame 3
putative reverse transcriptase [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041K06
Clone
Clone name
hba-41k6
LE_HBa0041K06
P041K06
Clone type
BAC
Contamination
none
Estimated length
80,608
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found