Clone Read LE_HBa0041K15_SP6_43132

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041K15_SP6_43132
Primer
SP6
ID from Seq. Facility
LE_HBa_041_K15-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
635 trimmed for vector and quality, 837 raw
Genbank Accession
Sequence
>LE_HBa0041K15_SP6_43132 (raw untrimmed)
CCACTTTTCGGCGTTCATCGGGACAACATAATTAATACTAAATNAGGAGGATTTCCAAAAGAAAAAATTAAGTTGGAAAAATGCTTTTGAAATTTCTTAA
GGAGAAAGCACACAAGTGAGTTATAAAATCGACCATTATCTCAGAACTGTTATACATACCCTCTATGAGAATTTTAACAAGATATCTATAAATGCTCCAA
ACTCAAGGTTAAAGGGTATAACAGTTTGTATGAGATTACCCTTTAAACTTTAAAGTCATTTGTAGAGCCTACTTCTTTGAGATATATATATTATAAGATA
TGACAAGGTGGACATACAGCTAGCAAGAAAATTCCGTTAGATATTCCTACATGCAATATTATATCGCTTCATTCTTCCATCACAAATGACATGTTTATTT
AATTAATAAAATAATAAACTAAATATGCACAGATAACTAACTGGCTTTAAAGCAATCAAAAGCTAAGGGCAATGTGGGTATTTTGATAAGCTAATAGGTG
ACTTCAGAACTACTCCCTCTGTCCCAAAGTACTTGTCAAGTATCGTTTTCTAGAGTGACTAATCTTCGGAGCTAAATTGAATTAGATTAATTTAATATTT
TAAGAGTAAAACTTATCGATTCATAAACTATATGAAAAAGTACTATAAGTTGCATTTTTTCTAATATCAATACGGGGGAAAATACATCTTAGAATGTTGG
ATAAGGGTTATGAAGTTTGACCCTTCGAAAAAGGAAATCGTGACAGATTCCGAACGGAGGGAGTTGTTGGAAGTTTTGCTAAAGACCCAAAAAAAAATTT
CCCGGTCCGCCCCCATTGAATTTAAAGGGGGATGAAT
>LE_HBa0041K15_SP6_43132 (trimmed for quality and cloning vector)
CAACATAATTAATACTAAATNAGGAGGATTTCCAAAAGAAAAAATTAAGTTGGAAAAATGCTTTTGAAATTTCTTAAGGAGAAAGCACACAAGTGAGTTA
TAAAATCGACCATTATCTCAGAACTGTTATACATACCCTCTATGAGAATTTTAACAAGATATCTATAAATGCTCCAAACTCAAGGTTAAAGGGTATAACA
GTTTGTATGAGATTACCCTTTAAACTTTAAAGTCATTTGTAGAGCCTACTTCTTTGAGATATATATATTATAAGATATGACAAGGTGGACATACAGCTAG
CAAGAAAATTCCGTTAGATATTCCTACATGCAATATTATATCGCTTCATTCTTCCATCACAAATGACATGTTTATTTAATTAATAAAATAATAAACTAAA
TATGCACAGATAACTAACTGGCTTTAAAGCAATCAAAAGCTAAGGGCAATGTGGGTATTTTGATAAGCTAATAGGTGACTTCAGAACTACTCCCTCTGTC
CCAAAGTACTTGTCAAGTATCGTTTTCTAGAGTGACTAATCTTCGGAGCTAAATTGAATTAGATTAATTTAATATTTTAAGAGTAAAACTTATCGATTCA
TAAACTATATGAAAAAGTACTATAAGTTGCATTTT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.935922
Expected error %
0.739379
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041K15
Clone
Clone name
hba-41k15
LE_HBa0041K15
C02HBa0041K15
P041K15
Clone type
BAC
Contamination
none
Estimated length
93,528
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found