Clone Read LE_HBa0041K16_SP6_43134

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0041K16_SP6_43134
Primer
SP6
ID from Seq. Facility
LE_HBa_041_K16-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
336 trimmed for vector and quality, 904 raw
Genbank Accession
Sequence
>LE_HBa0041K16_SP6_43134 (raw untrimmed)
GGGGTTTTACATCGGGNGTTCGTTAGATCGAAATTCGGGTTTTGATTATGATGTGTTTGTGAATAATACATTGATGTTGTTTTATGGGAGTTTTGGTGAT
TTGGTGAGTGCGGGGAAGATATTTGATGAAATGTCTGAAAGGGATTTGGTTTCATGGAACAGTATGATTCGGGTGTTCACGGATAATAGGTGTTATTTTG
AAGGTATTGGGGTGTTTAGGGAGATGGTTATGTGGTCTGAGTTTAAGCCGAATGTGGTAAGTGTTGTGAGTGTATTGCCTATTTGTGCAGTGCTGGAAGA
TGGGATAATGGTTAGTGAGATTCATTGTTATGTGATTAAAGTGGGTTTGGAATGTCAAGTGGCTATTGGGAATGCATTCATCCATGCATATGGGAAGTGT
TTGAATGTTGAGTTGTTTATTACTCGTTTATAATGATATTGCTGAAAGGAATGCTGGTTCCCTGGTATGCCCTGCTCCTGCCCCTTGCTTCCACTTGGGT
TTACATTCCACCTTGTAGAATACTACCCGGTCCCTTCAACTCACTCTCGATGTGTCTGATATATCTATTAAAGCCCCCTAATTCTGCTGTTAGTCTTCTC
TCTCTTTCTTCGGTGTTACGTCTCTCCTTCACCATGTGTGTCTAGGGGGTGTTCTATTCCTCTCTCTTTTTTGATTTGTGTCTTTTATTCTATTCTTGTT
CTTTCTTTTTTTTTAATGTTCTTGTCTTTCTAATTCTTACACTTTGTTTTTTTTCATTTTTTACTATAGCTACTTCCACTTTACTTATCGCTATAGTTTC
TCAGTTTTCGCATTTCCGTAACTATACCTTGCACGTTCACTCCTAACTTATCTGCCAATTTCCCCCCCCTTCCTGTTTCCTTTATCCTTTTTCATCGTAC
TTTT
>LE_HBa0041K16_SP6_43134 (trimmed for quality and cloning vector)
GTTTTGATTATGATGTGTTTGTGAATAATACATTGATGTTGTTTTATGGGAGTTTTGGTGATTTGGTGAGTGCGGGGAAGATATTTGATGAAATGTCTGA
AAGGGATTTGGTTTCATGGAACAGTATGATTCGGGTGTTCACGGATAATAGGTGTTATTTTGAAGGTATTGGGGTGTTTAGGGAGATGGTTATGTGGTCT
GAGTTTAAGCCGAATGTGGTAAGTGTTGTGAGTGTATTGCCTATTTGTGCAGTGCTGGAAGATGGGATAATGGTTAGTGAGATTCATTGTTATGTGATTA
AAGTGGGTTTGGAATGTCAAGTGGCTATTGGGAATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.872295
Expected error %
0.114108
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At2g37310.1 Score 86 E Value 5e-18 Identity 12.90% Align. Length 332bp (98.81%) Frame 1
68415.m04576 pentatricopeptide (PPR) repeat-containing protein contains Pfam profile PF01535: PPR repeat
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g18485.1 Score 83 E Value 3e-17 Identity 13.90% Align. Length 323bp (96.13%) Frame 1
68414.m02307 pentatricopeptide (PPR) repeat-containing protein contains INTERPRO:IPR002885 PPR repeats
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC98051.1| Score 86 E Value 4e-16 Identity 12.90% Align. Length 332bp (98.81%) Frame 1
hypothetical protein [Arabidopsis thaliana] ref|NP_181268.1| pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana] pir||B84791 hypothetical protein At2g37310 [imported] - Arabidopsis thaliana
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_564054.1| Score 83 E Value 3e-15 Identity 13.90% Align. Length 323bp (96.13%) Frame 1
pentatricopeptide (PPR) repeat-containing protein [Arabidopsis thaliana]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0041K16
Clone
Clone name
hba-41k16
LE_HBa0041K16
C02HBa0041K16
P041K16
Clone type
BAC
Contamination
none
Estimated length
93,579
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found