Clone Read LE_HBa0009K06_SP6_4330

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0009K06_SP6_4330
Primer
SP6
ID from Seq. Facility
LE_HBa_009_K06-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
304 trimmed for vector and quality, 919 raw
Genbank Accession
Sequence
>LE_HBa0009K06_SP6_4330 (raw untrimmed)
AAATCCCGAATTGGACAGGAACGATCGATTGAAGAGAGCGGTCATCCCCAGAACGAAGCCGTTGTTGCTGAAGATGACGACGTAGATGTCGATGAGGAGG
AGGAGGAAGAGGACGATTCCACTTCCTCTCCTCCCGTGCCCGTTGCGAACCATTCCGTCGCCGGAGAGGTTACTATAGCCGTTGTCGGTGTCCCTGCAAC
TGATTCACTTTGTATTGAACCAAAACGAGAGCGGATCAACGATTTCGGCGTTACTCCGGCCACGATGGTTGTGGAAGAAAAAAAGCCCTTAGTTTTGGAT
GATTCTCGCAAGCTTTTTCAACGGCTGTGGATGGATGAAGATGAGATCGAATTGTGACAAGGATTTCTGGAACTCTCTACCCAAATGGTTGGGATGAATT
CATCCGCATATCAGCATAAGGATACTTGTGCGTTCTATGACCTAATCAATATGCTGCTGCTCTTGGAGTGGAACAAGAATCAAGGCAATTCAGAAGCTGT
TGAGATTGTAAACAATTCCTCTTACTTGAGATGAGCAATATGGGATCTACTACTGGAGAAAAAGATTTGAACTACCACAATGAATGACACACTAGATCTT
GTTGAGCTTCATATTGATGGATCGATGAGTTACTGCTTGGGGTATACTAATTGCCCTTCCTAACCTTTGATGGAACAATTCATGGTCGTCAATAAAAAAG
GTTTCCTCCCATCTTTCCTAACTTGGGGACTCGTGCCTAGTTAGAATCAAAGTCCCTTCCATTTATTTTTTTTGAATCAAAAGGTGAATGTTATACTAAA
TATTTTTTATTTGGATAAATAGGAAAGGGGGAAGACCCTCCTGATAAAAAGCCCAACCATATTGTTTAACCTATAACCCCAATGGTTTTTGGGTTTGTCT
TTTTATTTTTTAAGAAAAC
>LE_HBa0009K06_SP6_4330 (trimmed for quality and cloning vector)
GAGAGCGGTCATCCCCAGAACGAAGCCGTTGTTGCTGAAGATGACGACGTAGATGTCGATGAGGAGGAGGAGGAAGAGGACGATTCCACTTCCTCTCCTC
CCGTGCCCGTTGCGAACCATTCCGTCGCCGGAGAGGTTACTATAGCCGTTGTCGGTGTCCCTGCAACTGATTCACTTTGTATTGAACCAAAACGAGAGCG
GATCAACGATTTCGGCGTTACTCCGGCCACGATGGTTGTGGAAGAAAAAAAGCCCTTAGTTTTGGATGATTCTCGCAAGCTTTTTCAACGGCTGTGGATG
GATG

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.962091
Expected error %
0.654268
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0009K06
Clone
Clone name
hba-9k6
LE_HBa0009K06
C02HBa0009K06
P009K06
Clone type
BAC
Contamination
none
Estimated length
158,936
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found