Clone Read LE_HBa0053B14_T7_43467

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0053B14_T7_43467
Primer
T7
ID from Seq. Facility
LE_HBa_053_B14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
174 trimmed for vector and quality, 877 raw
Sequence
>LE_HBa0053B14_T7_43467 (raw untrimmed)
ATGAATCCGCGACCCGAGGGGTACCTCTAAGGAGTCGACCTCGCATGGCTCGCAAGCTTCTTAATTGAGGAGGTCATATAATTCTTATAAGCGAGTTTTT
CAAA
AGTTATCCTATTTAAATTTTCTTTATCGACACAGCTGTTTACTAGACTTTAACTTCAGATAATGTCTCAGAGTCTCAGACCTTATCTCTGGTCCTT
TTTTCCAAGGATCTATCTGACTGGCTTCCTTCAAAATTTCAAAAGGCTTTTACAGTTGCTCCAATCCAAGTCAAGCTAAGCTGTAACTAGTAAGAACTTG
TGAATATAATGCATTAGCATGGATGCAGGACAAAGAGAATTAATTTCCTGGGACGGAGCTGTTACTAAGCATGTTTTCAGTTCACAATCTCTTAGCGTGT
CCACTAATTGTGCACGATTTTATTTTTATTTTTTTTTGTTATTTTTCAAAGAGTTTATATAAACTGATGTATACACAGGCTTGCATTATTGTGACTAGGT
ATGAAATTTAACCGTAATATTTAGGTATTTGAACGTTACAAGAATCATAAGGATCTTACTACTCTCAGAAACCAACTGAAAGAGAACCATGAATTAAGCA
GAAATCTCATCACACGTGCCGTCTACAACGTGGCCTCCGAAATCATGATAGTGCTCCTTATATCCAAAAGTATCCACACGACCTCTCCCGTATCAAAGAC
CGTAAAGATCACACGTAAGCAACCACGTCTTGTTATTCTTTCTCTATCTATACTTTATATTACGAACAATAGAACGCATCCACTGAAGACTAACATAGTT
TTTACTAGTCAGCTATAATTATCTTACTCTCTTTCTCTTAATTTCTCATTATTAACCCGGAGAGAGGTTTGTTAAAT
>LE_HBa0053B14_T7_43467 (trimmed for quality and cloning vector)
AGTTATCCTATTTAAATTTTCTTTATCGACACAGCTGTTTACTAGACTTTAACTTCAGATAATGTCTCAGAGTCTCAGACCTTATCTCTGGTCCTTTTTT
CCAAGGATCTATCTGACTGGCTTCCTTCAAAATTTCAAAAGGCTTTTACAGTTGCTCCAATCCAAGTCAAGCTA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.911559
Expected error %
1.25436
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0053B14
Clone
Clone name
hba-53b14
LE_HBa0053B14
P053B14
Clone type
BAC
Contamination
none
Estimated length
90,740
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found