Clone Read LE_HBa0053B23_T7_43485

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0053B23_T7_43485
Primer
T7
ID from Seq. Facility
LE_HBa_053_B23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
191 trimmed for vector and quality, 813 raw
Sequence
>LE_HBa0053B23_T7_43485 (raw untrimmed)
CGGGGGATACCTTCTTAGAGTTCGACCTTGCAGGCATAGCAAGCTGGCATACCATTAAGACTTAACTATCTTCTAAGTGAACCAGGTCAAAGGGGACGAA
ATAGATAAGAACCCCTCTACGGACCATCTATAATATCCATCTAACCCTAAGAAACTCCTAATATCAGTTGGAGATGTAGGTCTAGGTTAATTCTCCCCTT
CCTCTATTTTCTGGGTATCAACTCTAATCCCATCACTGGAAATAATGTGGCCTACAAATATAATAGACTCAAGATAAAACTCACAGTTAGATAACTTGAC
ATACAACTCTCTATCTTTTATAGTTTGGAGAGATATTGCAATATAACTATCATGATCTTTCTCATTCCTCGAATAGATTAAATTGTCATTCCTCATAATC
ATCACAGGCATATCTACTCTTTGCTTGCCTCTTCTCTTGCACACAGTCCATGCACGATGTACGCGTATTGTTTTACCCCATCGACCTGATAAGACACTCC
TCATGCTCATAACGTGTCTTGGAAGATGCCTTTGGAACATCTCATACCCGTACGCCTCCACACATGCGACCCTATTCTAATGCTACTTCTCTTATACCAG
TGTCACCTCAAGTCTATATACCAGTTCTCATTCTTCTACCTGACATCTCTTTTGACTGAACCTTTCGCTCCGAGCCGCTCCTACCGTTTTCCGTAACTCC
CTCCCTCTCCCCACCACACCTCCCACTCCTGCGAACTATCGTTAATTCTGCTTACGATGCATTAAGCACTCTCTTGACCACTCATTCCCCACTCAACCTC
TTGCTCGCCCAAT
>LE_HBa0053B23_T7_43485 (trimmed for quality and cloning vector)
ACCATTAAGACTTAACTATCTTCTAAGTGAACCAGGTCAAAGGGGACGAAATAGATAAGAACCCCTCTACGGACCATCTATAATATCCATCTAACCCTAA
GAAACTCCTAATATCAGTTGGAGATGTAGGTCTAGGTTAATTCTCCCCTTCCTCTATTTTCTGGGTATCAACTCTAATCCCATCACTGGAA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.937333
Expected error %
0.377294
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT39297.1| Score 84 E Value 1e-15 Identity 23.30% Align. Length 188bp (98.43%) Frame 3
putative gag-pol protein [Solanum demissum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT38792.1| Score 83 E Value 3e-15 Identity 22.80% Align. Length 188bp (98.43%) Frame 3
putative gag-pol polyprotein [Solanum demissum] gb|AAT38791.1| putative gag-pol polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0053B23
Clone
Clone name
hba-53b23
LE_HBa0053B23
C04HBa0053B23
P053B23
Clone type
BAC
Contamination
none
Estimated length
159,087
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found