Clone Read LE_HBa0053H05_SP6_43736

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0053H05_SP6_43736
Primer
SP6
ID from Seq. Facility
LE_HBa_053_H05-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
300 trimmed for vector and quality, 934 raw
Sequence
>LE_HBa0053H05_SP6_43736 (raw untrimmed)
TGGGGTATGGATTTTTTCAACTTTGAATGGTCTATTGTTGGTGTTGTGTCTTTTTATTTCTGTATGAATATGGTAAGGAGTAGTTAGTCTATAGTGTTTT
TCCTAATATGGTAAGAAGTACTTTGTGGAGTCGTAGTGATGCCTTTTACCTTTTCTTTCTTTCATAGAACACAGAATGATGTCTTCCTCACCTTGTATTT
TGAAATGTGTGCTCCCTTTTCCTTGTTTGAATGATACTTGCCATGAAGTCTTCATAATTACATTCTAAATATATACATGTTCATTTTTAGTTACACTGAT
TACATTTCTTCTTTGATGAAGTAGTACATTGATAATGATTTACCTTACTGCTTGAGTATATCTTCTTATGATGTTTCTTGCTGCTTTTCTTTTTCTTATA
AATTCCGAATTTTCTATTTCAGATAGGATCCTGATATGGCTGAAGAAGAAACAAATGGAGCAGCAGCAGAGGGTCTGCCACCTCCTCCCCCTGTTCCACC
AGATTTCACTCCTGCTAAAACTGAAATTGAGTCTGTAAAGAAAAAGATCTTGCGCGTTCCCATGGCCTTGCTTGGTGTTGGAAATTTTGGACAAACATTC
AAATACCTACTATTCACTTTAAAGTGAATGTTCACCAGGTGTATGGACATTTCTTACCCCATCTGTGTTGTTTGTTTAGTCACTAATTACTTCTCCGTGG
CGCTCTACTAATTCCCATATTTCATTATTCCCCTGTCTTTAACTCCATTCTTCGCCCGTCTTCTCTCTCCCCCCACGAGGTCGACTAGTGTATTGTATAG
CAGCCTGAAGGCTTCTTTTATCATTATTCTCCTTACTCATTACCTCTTTATTCCTGATTTATTTCGTGTTACTCTACCATTAACCTTTTTTCCATTAATA
TTCTCTCTTTGATTCTTTTTTTTTTTTTTTTGTC
>LE_HBa0053H05_SP6_43736 (trimmed for quality and cloning vector)
ATTGTTGGTGTTGTGTCTTTTTATTTCTGTATGAATATGGTAAGGAGTAGTTAGTCTATAGTGTTTTTCCTAATATGGTAAGAAGTACTTTGTGGAGTCG
TAGTGATGCCTTTTACCTTTTCTTTCTTTCATAGAACACAGAATGATGTCTTCCTCACCTTGTATTTTGAAATGTGTGCTCCCTTTTCCTTGTTTGAATG
ATACTTGCCATGAAGTCTTCATAATTACATTCTAAATATATACATGTTCATTTTTAGTTACACTGATTACATTTCTTCTTTGATGAAGTAGTACATTGAT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.913477
Expected error %
0.245035
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0053H05
Clone
Clone name
hba-53h5
LE_HBa0053H05
P053H05
Clone type
BAC
Contamination
none
Estimated length
134,280
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found