Clone Read LE_HBa0053K10_T7_43891

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0053K10_T7_43891
Primer
T7
ID from Seq. Facility
LE_HBa_053_K10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
738 trimmed for vector and quality, 947 raw
Sequence
>LE_HBa0053K10_T7_43891 (raw untrimmed)
CTTGGTCCCCGGGGGATCCTTCTAGAGTCGACCTGCAGGCATGCAAGCTTGTATGTTAAAAGACTTAAATTGCTCACTCTCCGATTTCTTTGTCTTATTT
TTAATTTTAATCCGTTTAGAAAAAAAAATGTTTTCTTTTCTTCTTTGATGATTCTTTAGTTTTAGCTTTTGACATGATATGTTTAAAACTATAAAATTAA
AGATACTTTGATATATTTATTTATCTCTTATTTTGCAAGTGCAAGATTAAAAGATTTTAGAAAAAAAAAAACTTCTAATCAGATCAAAACCAATAAACAA
ATCGAAATAGTGATAGTATTTTATTGCGAAATACTTTGAAAATTGAAATTGCAAGCAGATGGTTCACGTAACCATGATTGCATGTGTCATTATCATATAA
TTGTGGCATTATTTGTGGAAAACAAATGATGGAGGAGGTGATTGATTTAACATCATATGTTTCTCTTGGTTCAAATGGATCGGAGAAATCAATCATTGAA
CGACGATTGTTATATTTCATTTCAATATAAATAACATTTCAAATTAAAGTGTCAAATAGACCATCAAAATAAAGCGAGTAAAAATAAATGAATTAATAGC
CTTACACGCTCAACTCTTATTCTATATGAAGGATAATTTCTCATTATATTCTTTGTCAGTAGCAGGGATAGAAATTTCATAAAGGGTGTTCAGAAATAAC
AGTATGTTATATTAAGGGTGTCCAAACTATATTTATTTTAACCTTTGCAAATATCATATTACTTGTATTTTTTTATTATTTTCCGACAAAGGGTGTCCAA
TTTGACCCCGGTAGAAACTAAATATCATGTTCTAAACTAGTTTAGGTTTCATCAACTTTCTTCAATCTTGGTTTTAAACCTAAAAATAATTTTGAAAATC
CGTTGATATTTTCCATTATTAATAAATTCCTTTTTTGGATTCTGGTN
>LE_HBa0053K10_T7_43891 (trimmed for quality and cloning vector)
AGCTTGTATGTTAAAAGACTTAAATTGCTCACTCTCCGATTTCTTTGTCTTATTTTTAATTTTAATCCGTTTAGAAAAAAAAATGTTTTCTTTTCTTCTT
TGATGATTCTTTAGTTTTAGCTTTTGACATGATATGTTTAAAACTATAAAATTAAAGATACTTTGATATATTTATTTATCTCTTATTTTGCAAGTGCAAG
ATTAAAAGATTTTAGAAAAAAAAAAACTTCTAATCAGATCAAAACCAATAAACAAATCGAAATAGTGATAGTATTTTATTGCGAAATACTTTGAAAATTG
AAATTGCAAGCAGATGGTTCACGTAACCATGATTGCATGTGTCATTATCATATAATTGTGGCATTATTTGTGGAAAACAAATGATGGAGGAGGTGATTGA
TTTAACATCATATGTTTCTCTTGGTTCAAATGGATCGGAGAAATCAATCATTGAACGACGATTGTTATATTTCATTTCAATATAAATAACATTTCAAATT
AAAGTGTCAAATAGACCATCAAAATAAAGCGAGTAAAAATAAATGAATTAATAGCCTTACACGCTCAACTCTTATTCTATATGAAGGATAATTTCTCATT
ATATTCTTTGTCAGTAGCAGGGATAGAAATTTCATAAAGGGTGTTCAGAAATAACAGTATGTTATATTAAGGGTGTCCAAACTATATTTATTTTAACCTT
TGCAAATATCATATTACTTGTATTTTTTTATTATTTTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.907776
Expected error %
0.621739
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0053K10
Clone
Clone name
hba-53k10
LE_HBa0053K10
P053K10
Clone type
BAC
Contamination
none
Estimated length
110,406
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found