Clone Read LE_HBa0056B08_SP6_44222

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0056B08_SP6_44222
Primer
SP6
ID from Seq. Facility
LE_HBa_056_B08-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
450 trimmed for vector and quality, 746 raw
Sequence
>LE_HBa0056B08_SP6_44222 (raw untrimmed)
GATCATACTCTAAAAGTCGGGGTTGTGTTGTCCGGAGGACAGGCTCCTGGTGGGCACAATGTCATCTCTGGAATTTTTGGTGAGTGCTTTTCCAATAGTT
CCTACTTAATGGTATTTACTTTTTTGTAGTTCTGTGCATATGTGTAGTTATTACATATTAGTACATAAGCGTGTATCTCAGCAATTAGTTGACTATTTTT
CTCTAGACTATTTGCAGGAGAAAACGAAAAATAGCACACTCTATGGATTCAAGGGAGGTCCAGCAGGGATAATGAACTGTAAATATGTAGAGTTGACAGC
GGATTTTGTTTATCCTTACAGAAATCAAGTAAGAAATTTACTTTCCATCTTCCACTTAATATACATGGTCTTTGTTTGCACTTGTTCCAAACAGTTTCTT
CTATAGCAAATTATGCTTGTGGACTTTTATGGAAAAAATATTTTTCTATTCGAGTTATCCGTAACAATATGATGGCAGCGTATTTAGTTTCTGATGTGGG
AGCTTTTGCACCATTTTTTTTTTTTTGTAATCGAAATTTTCCTTAAAAGCCAAGTTATGGACTCACTTTGCTTACCATACCTTGTCACAGCTTATCTAAC
CTTCCGCGAGTAATCCCACACTCCTATCCTCCCCTTGACATCATTGCTACCCTTCCTGGAGTTACCGCCAAAAAATTCGAAATAGACTTCAAACCTTGGA
AAAATAAGTTTTTTGGAGTACAATTCAAAAGCCCCAGGCAAAAAAC
>LE_HBa0056B08_SP6_44222 (trimmed for quality and cloning vector)
GATCATACTCTAAAAGTCGGGGTTGTGTTGTCCGGAGGACAGGCTCCTGGTGGGCACAATGTCATCTCTGGAATTTTTGGTGAGTGCTTTTCCAATAGTT
CCTACTTAATGGTATTTACTTTTTTGTAGTTCTGTGCATATGTGTAGTTATTACATATTAGTACATAAGCGTGTATCTCAGCAATTAGTTGACTATTTTT
CTCTAGACTATTTGCAGGAGAAAACGAAAAATAGCACACTCTATGGATTCAAGGGAGGTCCAGCAGGGATAATGAACTGTAAATATGTAGAGTTGACAGC
GGATTTTGTTTATCCTTACAGAAATCAAGTAAGAAATTTACTTTCCATCTTCCACTTAATATACATGGTCTTTGTTTGCACTTGTTCCAAACAGTTTCTT
CTATAGCAAATTATGCTTGTGGACTTTTATGGAAAAAATATTTTTCTATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.94621
Expected error %
0.422999
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g12000.1 Score 74 E Value 3e-14 Identity 25.20% Align. Length 122bp (27.11%) Frame 3
68414.m01386 pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative strong similarity to SP|Q41141 Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.90) (PFP) ((PPI-PFK) {Ricinus communis}; contains Pfam profile PF00365: Phosphofructokinase
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g04040.1 Score 70 E Value 3e-22 Identity 69.00% Align. Length 327bp (72.67%) Frame 2
68417.m00574 pyrophosphate--fructose-6-phosphate 1-phosphotransferase beta subunit, putative / pyrophosphate-dependent 6-phosphofructose-1-kinase, putative strong similarity to SP|Q41141 Pyrophosphate--fructose 6-phosphate 1-phosphotransferase beta subunit (EC 2.7.1.90) (PFP) (6-phosphofructokinase, pyrophosphate-dependent) (Pyrophosphate-dependent 6-phosphofructose-1-kinase) (PPI-PFK) {Ricinus communis}
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
dbj|BAD45669.1| Score 78 E Value 9e-14 Identity 26.80% Align. Length 122bp (27.11%) Frame 3
putative pyrophosphate-dependent phosphofructokinase beta subunit [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC17614.1| Score 75 E Value 3e-22 Identity 72.70% Align. Length 318bp (70.67%) Frame 2
Similar to pyrophosphate-dependent phosphofuctokinase beta subunit gb|Z32850 from Ricinus communis. ESTs gb|N65773, gb|N64925 and gb|F15232 come from this gene. [Arabidopsis thaliana] pir||A86255 hypothetical protein [imported] - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0056B08
Clone
Clone name
hba-56b8
LE_HBa0056B08
P056B08
Clone type
BAC
Contamination
none
Estimated length
89,943
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found