Clone Read LE_HBa0056B08_T7_44223

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0056B08_T7_44223
Primer
T7
ID from Seq. Facility
LE_HBa_056_B08-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
580 trimmed for vector and quality, 823 raw
Sequence
>LE_HBa0056B08_T7_44223 (raw untrimmed)
ATTTGCAAATTTTCAAATAAATTGAGAGTTCGGTAATAATATTAGTGAAACTGAACCCATATGGCAGAAAGCAGAAGCGGCGGGTATGTCTGTCCGGGTT
CATTCATGTCCAATAAACTTGAGTCATGAATTATTTTTTGAATTTTTAAAACATTGAATAATATAATGCAGTAATGAGAATTGTTTATCCTCATAATCAT
AGATCTCGCATTCAAACCCTAGATATATGATAAAAAATTTCTTAATATGGAGAGATTCCTCTAAAGGGGCCCGTTTATGTTGTGAGAATATCCTGATAGA
ATAATAATAAAAATAAAAATCGATTAATAAAATAAAAAGGAAATAAACTATTTTTAGTACATTACTTTCCATTTTGATTTTATTAGTTGTGGAAAACAAT
GAAGGAATTATGTGATCAGACACTCGGAGGGTAATAAAAGCATCAGCATAACTAATAGGATCGTAATAATTACTAAATACTCTTTTATTCTTGATTATAA
TTCAGAAATATCGATTTTGAGTTGTCATAATTATGAAATTATCTTTGTTAAAAAGTGTTTTATTCTTTTTGACATGATTTTTAGATCTAGTCGAACTCTA
AATATCACTGCGGACACCGATTAAAAAAAAACATCAACATGAATGTTTTTTTTTTTAATTATACCGCGGGTCATTAATTTGTTTAATAATTGCAAATTCT
AAACCCATTGGATTGATAAAAATTTGAATCCAAACCCCTTTGATAACTCCACCAAAGTCAAATTTTTACTACTTTTAATTTCTGGATATTTCTTTTTGAA
GAAAAATTTGATTTTTTGCCTCT
>LE_HBa0056B08_T7_44223 (trimmed for quality and cloning vector)
GTTCGGTAATAATATTAGTGAAACTGAACCCATATGGCAGAAAGCAGAAGCGGCGGGTATGTCTGTCCGGGTTCATTCATGTCCAATAAACTTGAGTCAT
GAATTATTTTTTGAATTTTTAAAACATTGAATAATATAATGCAGTAATGAGAATTGTTTATCCTCATAATCATAGATCTCGCATTCAAACCCTAGATATA
TGATAAAAAATTTCTTAATATGGAGAGATTCCTCTAAAGGGGCCCGTTTATGTTGTGAGAATATCCTGATAGAATAATAATAAAAATAAAAATCGATTAA
TAAAATAAAAAGGAAATAAACTATTTTTAGTACATTACTTTCCATTTTGATTTTATTAGTTGTGGAAAACAATGAAGGAATTATGTGATCAGACACTCGG
AGGGTAATAAAAGCATCAGCATAACTAATAGGATCGTAATAATTACTAAATACTCTTTTATTCTTGATTATAATTCAGAAATATCGATTTTGAGTTGTCA
TAATTATGAAATTATCTTTGTTAAAAAGTGTTTTATTCTTTTTGACATGATTTTTAGATCTAGTCGAACTCTAAATATCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.919745
Expected error %
0.267812
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0056B08
Clone
Clone name
hba-56b8
LE_HBa0056B08
P056B08
Clone type
BAC
Contamination
none
Estimated length
89,943
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found