Clone Read LE_HBa0056N10_T7_44803

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0056N10_T7_44803
Primer
T7
ID from Seq. Facility
LE_HBa_056_N10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
683 trimmed for vector and quality, 892 raw
Sequence
>LE_HBa0056N10_T7_44803 (raw untrimmed)
TTGAAAGCCCGGGTTTCCGGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTGTCATGTCTAATCTACTTACTTCCCCTAGCATTCTTATCTC
TGCCACATTTTTCTTTTGAAGTTGAGCATTTTTCTGATATAACAATACCGATCTAACCACTAGTCATAGAACCTACCTTGAATAATGGACCCACGATACT
TAAAACTTCCTCTTTTATATATGACTTATGCAATGATGTTCACTTCTCAACCTTTGTCTCATGCATTACATCACTAAACATAGCTCCATGTACTTAATTA
TGGTCCTACTTAACCTAAAACCTTTAGACTTTAGTGTTTGTCTTGAAGCTTTAAACCTTTCTTTAACTTCATCACACGTCTCGTCAATTAATATTATGTT
ATCTGCGAAAAATATGTACCACAATGCCTCACATTGAATATGACATGTCATTTCGTTCACTATTAAGGCAAATAAAAATGGGCTAAGAGTTGATCCTTGC
TGTGACCCCATCATGACTAGGAAGTGATCCAAATCACCTCCAATTGTCTTAACCCAAATTTTGAATCCATCGTACATGTCCTTAATAGACCTAACGTACA
ACAAATATTTAAGTCTCTCTTCTTGCCCTTGGAATCTTCTTACAAGATGCATGGCTTTTGTTATTGACCATCATGACATGATTGCAAATGGATTCTCAAA
GATAATACACCCCTACTCTATCTCATCTTTATCATCCCTCCTTTAAACTTGTTAGTAGCCTGATACTCTCGGAGTTAATGGAACTTTTAATTTATTCGTT
TCTGTGCCTTTGAAAATTAAACAACTTGGACCAATTTCTTGGATGTCTATGAATTTTTTAGCCGCCCCTTAAAAATACCCTCTCAATAATTC
>LE_HBa0056N10_T7_44803 (trimmed for quality and cloning vector)
AGCTTTGTCATGTCTAATCTACTTACTTCCCCTAGCATTCTTATCTCTGCCACATTTTTCTTTTGAAGTTGAGCATTTTTCTGATATAACAATACCGATC
TAACCACTAGTCATAGAACCTACCTTGAATAATGGACCCACGATACTTAAAACTTCCTCTTTTATATATGACTTATGCAATGATGTTCACTTCTCAACCT
TTGTCTCATGCATTACATCACTAAACATAGCTCCATGTACTTAATTATGGTCCTACTTAACCTAAAACCTTTAGACTTTAGTGTTTGTCTTGAAGCTTTA
AACCTTTCTTTAACTTCATCACACGTCTCGTCAATTAATATTATGTTATCTGCGAAAAATATGTACCACAATGCCTCACATTGAATATGACATGTCATTT
CGTTCACTATTAAGGCAAATAAAAATGGGCTAAGAGTTGATCCTTGCTGTGACCCCATCATGACTAGGAAGTGATCCAAATCACCTCCAATTGTCTTAAC
CCAAATTTTGAATCCATCGTACATGTCCTTAATAGACCTAACGTACAACAAATATTTAAGTCTCTCTTCTTGCCCTTGGAATCTTCTTACAAGATGCATG
GCTTTTGTTATTGACCATCATGACATGATTGCAAATGGATTCTCAAAGATAATACACCCCTACTCTATCTCATCTTTATCATC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.948398
Expected error %
1.30512
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAT40504.1| Score 103 E Value 2e-23 Identity 56.50% Align. Length 387bp (56.66%) Frame 3
putative polyprotein [Solanum demissum]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0056N10
Clone
Clone name
hba-56n10
LE_HBa0056N10
C05HBa0056N10
P056N10
Clone type
BAC
Contamination
none
Estimated length
112,724
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found