Clone Read LE_HBa0057C07_SP6_45036

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057C07_SP6_45036
Primer
SP6
ID from Seq. Facility
LE_HBa_057_C07-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
767 trimmed for vector and quality, 893 raw
Sequence
>LE_HBa0057C07_SP6_45036 (raw untrimmed)
AAACGGTTTTNCNNTACTCTAGTGGAATTTNGATTGACTTTGGAATTTTTAACTGTGATACATTAATTGGGACAGTGGGAGTAATAAATACGTTATGTAG
CCTCACCTTCAAACTGAGAGAACAGAGGACAAACTGGTCAACTTTTGAAACATTGAGATGAAGAACAGTTAGCCTAAGACTTTCAAGCCCTGAAATAATT
GTAGGAAGCAATCTTGGCCTCTTTTTTGATCTGATTTTCAGATTTGCATGATTTTCCACCATTGTAACTTCTATATCAGCTGTTGCTGGTAGCTGCTGGT
TCCTGTAATATTCATTCTCACAACATACATTTTCACTAGTAGTAGTAGCAGCAGCAGCAGCAGTGATGGTTGTGGAGTACTGTGGAATGCTAAAGAATTC
AGAAAATGGAGAAGTTTCACCATTTGCTTCTTGATTTTGACTTGTCAAATGCTTCTTACCACTAAGGAATTGAAGTTGTTGCTCTAGCTCTTTCACATAG
TTAATTGCACCACTAACAATTGATGCTTGATCACCCTTAAAATGTAAAAAAAAGCAAATAGTTTTAGAATAGATCGTCTATCTAACAGCTTAAACTTTTC
GATTAAGTGAACATAAGATTTCACCACCATCGAATTAAAAAGAAATTTGACATCTCAAACTTATATATAAAATGAAATTGAGAGAAGGAAATCTGACCCT
TTGGACATAAGATTCAGGCATGAGAGTACGGAGAACAGAGAGGTAGTCATTCATCTGTTTTCGACGATTTCGTTCAACAGCAATGTGTGTAATTCGTTGA
TTCTCAATCTCTTCGTCTTTCTTCTTTGTTCTTGTTCTTCTTCTTCGTGGTCTAGTTTGTACTACTTAGACATTTTCGATTGGGAGAACTCCA
>LE_HBa0057C07_SP6_45036 (trimmed for quality and cloning vector)
ATTTTTAACTGTGATACATTAATTGGGACAGTGGGAGTAATAAATACGTTATGTAGCCTCACCTTCAAACTGAGAGAACAGAGGACAAACTGGTCAACTT
TTGAAACATTGAGATGAAGAACAGTTAGCCTAAGACTTTCAAGCCCTGAAATAATTGTAGGAAGCAATCTTGGCCTCTTTTTTGATCTGATTTTCAGATT
TGCATGATTTTCCACCATTGTAACTTCTATATCAGCTGTTGCTGGTAGCTGCTGGTTCCTGTAATATTCATTCTCACAACATACATTTTCACTAGTAGTA
GTAGCAGCAGCAGCAGCAGTGATGGTTGTGGAGTACTGTGGAATGCTAAAGAATTCAGAAAATGGAGAAGTTTCACCATTTGCTTCTTGATTTTGACTTG
TCAAATGCTTCTTACCACTAAGGAATTGAAGTTGTTGCTCTAGCTCTTTCACATAGTTAATTGCACCACTAACAATTGATGCTTGATCACCCTTAAAATG
TAAAAAAAAGCAAATAGTTTTAGAATAGATCGTCTATCTAACAGCTTAAACTTTTCGATTAAGTGAACATAAGATTTCACCACCATCGAATTAAAAAGAA
ATTTGACATCTCAAACTTATATATAAAATGAAATTGAGAGAAGGAAATCTGACCCTTTGGACATAAGATTCAGGCATGAGAGTACGGAGAACAGAGAGGT
AGTCATTCATCTGTTTTCGACGATTTCGTTCAACAGCAATGTGTGTAATTCGTTGATTCTCAATCTC

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.954615
Expected error %
0.113204
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g22490.1 Score 108 E Value 3e-24 Identity 53.00% Align. Length 707bp (92.18%) Frame 1
68414.m02810 basic helix-loop-helix (bHLH) family protein contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At1g72210.1 Score 108 E Value 4e-24 Identity 53.60% Align. Length 707bp (92.18%) Frame 1
68414.m08349 basic helix-loop-helix (bHLH) family protein (bHLH096) identical to basic-helix-loop-helix transcription factor [Arabidopsis thaliana] GI:20520637; contains Pfam profile: PF00010 helix-loop-helix DNA-binding domain; PMID: 12679534
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
ref|NP_912559.1| Score 145 E Value 1e-33 Identity 14.30% Align. Length 707bp (92.18%) Frame 1
Unknown protein [Oryza sativa (japonica cultivar-group)] gb|AAN64142.1| Unknown protein [Oryza sativa (japonica cultivar-group)]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAO45750.1| Score 139 E Value 8e-32 Identity 13.50% Align. Length 725bp (94.52%) Frame 1
helix-loop-helix-like protein [Cucumis melo]
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057C07
Clone
Clone name
hba-57c7
LE_HBa0057C07
C01HBa0057C07
P057C07
Clone type
BAC
Contamination
none
Estimated length
110,866
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found