Clone Read LE_HBa0057C07_T7_45037

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057C07_T7_45037
Primer
T7
ID from Seq. Facility
LE_HBa_057_C07-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
772 trimmed for vector and quality, 868 raw
Sequence
>LE_HBa0057C07_T7_45037 (raw untrimmed)
CGGGGTCCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTGATTTGCTTAACTTCTGTTTTTTGCTCCAGTTTCTTTGTTTATTTTGGCC
TATGATGTCAAATGTCCTATATGAAATTTTAACCTCTTTCCCCAACATTTGGCAGGTTGTTCCTCAGTTGTCCTGTCCTATTGCTTTGTTCACCTATTAT
AATCCAATACTCAAGCGCGGTACTGAGAAGTTCATGGCCACTGTAAGGGATACTGGTGTACACGGTAATCTTTAGTTCAATGTTAAAATTATTAGTGCTA
CAATGTTTCTTACCAAAAGATATGCATTGCCCAAATAACATGAAACATTCAATGACTCTTCATGTATGCCTTTCTTTCCATTGTGAATTCAAACTTCTAC
TGGCATGGAGTTGCCCTTGGGATATGGCGTCTTATATTGGTTCTTTACCGTTTAATATTTCAACTTTGTGCATGAAGGCCGGATTAATCTTCTATCACAA
CGCATAACCTGCATTAGTTTCAGCAGGAATACTTAAGCCATAAATGGAGATGGACGGTACTAGATTTTCTAGCATATGAAGGATCTGTGAACTGGTGACC
ATTATTTTATAATTCCCTTCTGCAGTGGAGTAGTTCTTTTTATGCTTCTGACCAGTGTTGTCAAAGACGCACTTTAGTGCTGAAGTGATGCACAAAACAT
GTTGAGTGCTCCCCCTCGCTTAATGGGCGCTTCAATTTCGTCATAAAGGCTCTGTGGCTAGTTTTTCCTTGCCAATGAGTGTATTCCTGAAGAGGCAACT
CTAAACAATTGATATTTTATTCTCAACTCTATTCCTGAACTGGGTCTTTTAAATATTTTTTTTTTCAT
>LE_HBa0057C07_T7_45037 (trimmed for quality and cloning vector)
AGCTTTTGATTTGCTTAACTTCTGTTTTTTGCTCCAGTTTCTTTGTTTATTTTGGCCTATGATGTCAAATGTCCTATATGAAATTTTAACCTCTTTCCCC
AACATTTGGCAGGTTGTTCCTCAGTTGTCCTGTCCTATTGCTTTGTTCACCTATTATAATCCAATACTCAAGCGCGGTACTGAGAAGTTCATGGCCACTG
TAAGGGATACTGGTGTACACGGTAATCTTTAGTTCAATGTTAAAATTATTAGTGCTACAATGTTTCTTACCAAAAGATATGCATTGCCCAAATAACATGA
AACATTCAATGACTCTTCATGTATGCCTTTCTTTCCATTGTGAATTCAAACTTCTACTGGCATGGAGTTGCCCTTGGGATATGGCGTCTTATATTGGTTC
TTTACCGTTTAATATTTCAACTTTGTGCATGAAGGCCGGATTAATCTTCTATCACAACGCATAACCTGCATTAGTTTCAGCAGGAATACTTAAGCCATAA
ATGGAGATGGACGGTACTAGATTTTCTAGCATATGAAGGATCTGTGAACTGGTGACCATTATTTTATAATTCCCTTCTGCAGTGGAGTAGTTCTTTTTAT
GCTTCTGACCAGTGTTGTCAAAGACGCACTTTAGTGCTGAAGTGATGCACAAAACATGTTGAGTGCTCCCCCTCGCTTAATGGGCGCTTCAATTTCGTCA
TAAAGGCTCTGTGGCTAGTTTTTCCTTGCCAATGAGTGTATTCCTGAAGAGGCAACTCTAAACAATTGATAT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963037
Expected error %
0.502914
Sequence Annotations 
Automatic Annotations
Arabidopsis proteins (TAIR10) (ath/ATH_pep)NCBI BLAST
At4g02610.1 Score 66 E Value 2e-11 Identity 22.50% Align. Length 119bp (15.41%) Frame 3
68417.m00355 tryptophan synthase, alpha subunit, putative similar to A. thaliana tryptophan synthase alpha chain (EC 4.2.1.20), GenBank accession number U18993 (gi:619753)
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057C07
Clone
Clone name
hba-57c7
LE_HBa0057C07
C01HBa0057C07
P057C07
Clone type
BAC
Contamination
none
Estimated length
110,866
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found