Clone Read LE_HBa0057C21_SP6_45064

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057C21_SP6_45064
Primer
SP6
ID from Seq. Facility
LE_HBa_057_C21-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
691 trimmed for vector and quality, 841 raw
Sequence
>LE_HBa0057C21_SP6_45064 (raw untrimmed)
AAAGGGCTTTCTTTTAACTAGGGAGNNAAAAAAGTACTAGGGCTTAAGTGTTCCCCACAGGCTCCTAACTTGATAATTCAAACTATAACATTTATTTCCT
AGTATCTAGCATGTAAAGTGATAAGCTATGGATCTCTAAATCCTTGGTCCGTCATCTAGAAAATTTCACTTTGGACCTTGGTCCGGCTACGGGTCTTTCT
AAACTAACCCTTACCATTACTTCATATTAAGCATTATTCGATATTTGACTAAGTTATTACTTCATACCAATCGACACTAGCCTATTAGATAGTGTACACT
AAATCTATGTAGATAATTCTTTTTGTATTATCTACCTCCTTTGTCCGGTAAGTAGCACTAAGGCGAGTTCTAATGTTGGCCATTCATTAAAAAGACTTCT
AAATGAAAGAATTATCATTACATGCAAGTCACTATCCAAGAATTGCTATTTTAGTTAGATTCTACCTCATTATTTACCCATGGTTTCCACAACCATAGTT
ATGGAGTTTAGTTGCTCATAGTCATAATCACACTATTCATATATTTAATATAAGAATTCATGCACTTAATTTAATGATAAAGAATAAAATCTAGAAATTC
ACTTGATTAATCAACAAAAGCACCAACAATCAATTCCAGAAAAAGTGTAACAATTGCTGAAATTAGTCCTTCAATACTTGAACAAGCGAATGAAAGATTA
TCCAAAAGTCTAACCTTAAAAACGAGGTTTTTCAAACTATTTATAATAAAAACAAAAACCTAATAAAAAAGAATTTTAATCATTGAAAATTCTTTCAAAA
TGCATCTGAAGTCGATGAAACCTCCTGATGGGAACTTCGTT
>LE_HBa0057C21_SP6_45064 (trimmed for quality and cloning vector)
ACTAGGGCTTAAGTGTTCCCCACAGGCTCCTAACTTGATAATTCAAACTATAACATTTATTTCCTAGTATCTAGCATGTAAAGTGATAAGCTATGGATCT
CTAAATCCTTGGTCCGTCATCTAGAAAATTTCACTTTGGACCTTGGTCCGGCTACGGGTCTTTCTAAACTAACCCTTACCATTACTTCATATTAAGCATT
ATTCGATATTTGACTAAGTTATTACTTCATACCAATCGACACTAGCCTATTAGATAGTGTACACTAAATCTATGTAGATAATTCTTTTTGTATTATCTAC
CTCCTTTGTCCGGTAAGTAGCACTAAGGCGAGTTCTAATGTTGGCCATTCATTAAAAAGACTTCTAAATGAAAGAATTATCATTACATGCAAGTCACTAT
CCAAGAATTGCTATTTTAGTTAGATTCTACCTCATTATTTACCCATGGTTTCCACAACCATAGTTATGGAGTTTAGTTGCTCATAGTCATAATCACACTA
TTCATATATTTAATATAAGAATTCATGCACTTAATTTAATGATAAAGAATAAAATCTAGAAATTCACTTGATTAATCAACAAAAGCACCAACAATCAATT
CCAGAAAAAGTGTAACAATTGCTGAAATTAGTCCTTCAATACTTGAACAAGCGAATGAAAGATTATCCAAAAGTCTAACCTTAAAAACGAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.946906
Expected error %
0.0452809
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057C21
Clone
Clone name
hba-57c21
LE_HBa0057C21
P057C21
Clone type
BAC
Contamination
none
Estimated length
118,370
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found