Clone Read LE_HBa0057C21_T7_45065

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057C21_T7_45065
Primer
T7
ID from Seq. Facility
LE_HBa_057_C21-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
772 trimmed for vector and quality, 832 raw
Sequence
>LE_HBa0057C21_T7_45065 (raw untrimmed)
CGGGTACCGCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTCATGCATGAAGAGGAGGAACTTAACCTACCAAATCAAGACACAACATTCTAT
CATATCGTTCATGTATCAAGTAGGAAAAACTAAGTCTACCTAAGCATGACACCCTATCCACATATAAAGACTCTTCATATTGTAACATCATCATATATCA
ATAATAAGAGAAGGAGTACTTTCAATCATAACATTATTGCATCCATATAACACAATATAGGCATTACTTGAGTACCTTTACATTATACATTCACATATAT
CATATCATCATTCACTTTGTACATCCATATAAGCTCTAAATGATAATATTACAATTCACATAATAGTACCGACAAGGCCATAATCATAACATTTACAATA
ATTAAATACCACCACCATAAGTGGACCATACCAATCAATAGCAATTCGATATTAATTCTACATTAAATAGGGGAATTAAGTAAACTTATCACCTTCCAAC
AGCCAAAATCACCATCCCTAACATCTCCAACAATATCATGCATTAATAGAACTTACTAATTACATTGTTCAAAAGACTAGACCACCAATTCATCCATATC
GATGATTCAACAAAACCCAAGATAGATATCAATACTACAAATCAAACTATGAACAATTACAATATTGATCAACATATAATTTCAATAGCCCATAGCAATC
TCAACATGAATTCAACATAATTAGATCATAATCAATATACCCACTTTAGAGACAAAATTAGGAATTCAAGAAATGCATGGGGTTCGTGAAATTTTTTTAT
CTTAAAACCATCAATTAATATTGAAATACTTC
>LE_HBa0057C21_T7_45065 (trimmed for quality and cloning vector)
AGCTTTCATGCATGAAGAGGAGGAACTTAACCTACCAAATCAAGACACAACATTCTATCATATCGTTCATGTATCAAGTAGGAAAAACTAAGTCTACCTA
AGCATGACACCCTATCCACATATAAAGACTCTTCATATTGTAACATCATCATATATCAATAATAAGAGAAGGAGTACTTTCAATCATAACATTATTGCAT
CCATATAACACAATATAGGCATTACTTGAGTACCTTTACATTATACATTCACATATATCATATCATCATTCACTTTGTACATCCATATAAGCTCTAAATG
ATAATATTACAATTCACATAATAGTACCGACAAGGCCATAATCATAACATTTACAATAATTAAATACCACCACCATAAGTGGACCATACCAATCAATAGC
AATTCGATATTAATTCTACATTAAATAGGGGAATTAAGTAAACTTATCACCTTCCAACAGCCAAAATCACCATCCCTAACATCTCCAACAATATCATGCA
TTAATAGAACTTACTAATTACATTGTTCAAAAGACTAGACCACCAATTCATCCATATCGATGATTCAACAAAACCCAAGATAGATATCAATACTACAAAT
CAAACTATGAACAATTACAATATTGATCAACATATAATTTCAATAGCCCATAGCAATCTCAACATGAATTCAACATAATTAGATCATAATCAATATACCC
ACTTTAGAGACAAAATTAGGAATTCAAGAAATGCATGGGGTTCGTGAAATTTTTTTATCTTAAAACCATCAA

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.903816
Expected error %
0.199483
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057C21
Clone
Clone name
hba-57c21
LE_HBa0057C21
P057C21
Clone type
BAC
Contamination
none
Estimated length
118,370
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found