Clone Read LE_HBa0057E10_T7_45139

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057E10_T7_45139
Primer
T7
ID from Seq. Facility
LE_HBa_057_E10-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
732 trimmed for vector and quality, 885 raw
Sequence
>LE_HBa0057E10_T7_45139 (raw untrimmed)
CGCGGTCCGGGGGGTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGAAGGGAGATTGAAGTTTGAAGGTTGATTTCTCCAAAAAAATCTATCAATTTT
TGTGGATTAACATCAGTTTAGGTATGTTTATTCATCCCTGAAAATTCTATCATCAAGGATCCAATCTTCAAAGTGTTTTTCAAATACTTCTAAAAAGATG
AGTTTTCTAAATTGAAATCTATCCATGGGTTCTTGCATTAAATGTTTTGAATTGTATTATATTGATGTATAGGTTGTATTAGATTGATAAATCTACGTTG
AATTGACTTAGATGCATTGAGTATTATGATTTTTGCATTGAAATGATGATCATGGTCATGGGTAAGGGCCTTTTGGTATTGTATTGGATGATTTAGCTAT
GGATTGAAGTGGTGAAAATGGATTGGTGGTACGCTGCCCTAAATCTCTTGATATTATGTAAATTAGGTCTTGAATTATGTTGTGATTGGTATGGTCCACT
TATGGTGGTGGTGCTTTGTGTTTACTTGTGAATTGTGTGGCCTTGTCGGCATTACTTTATGTATTATTATGATAATGGCCTTGTCGGCATTACTTGGTAT
ATTATGATGATTTGTGCAGTTGACTTATTTGAAGTATGCTCATATATATCTACATGTGATTAAGGTGAAACTATATGTTTCTTCTATTGGTATTAGACGA
TCATGTTAGACTAGCACTATGTCCTTAGGTGTGTAGTCTTAGATTGAGTGCATGATTCTTCCTAATTGGCTATGTGAGTCTTGTGATGGTTATGTTGAAG
AATCTATCCTAATTGTAAAGGGTTAACCTAAAGTTTGGTTTGGTTTTTCCTAAGGTGGCTACTTGTAAGAAAATACCTTATATGT
>LE_HBa0057E10_T7_45139 (trimmed for quality and cloning vector)
AGCTTGAAGGGAGATTGAAGTTTGAAGGTTGATTTCTCCAAAAAAATCTATCAATTTTTGTGGATTAACATCAGTTTAGGTATGTTTATTCATCCCTGAA
AATTCTATCATCAAGGATCCAATCTTCAAAGTGTTTTTCAAATACTTCTAAAAAGATGAGTTTTCTAAATTGAAATCTATCCATGGGTTCTTGCATTAAA
TGTTTTGAATTGTATTATATTGATGTATAGGTTGTATTAGATTGATAAATCTACGTTGAATTGACTTAGATGCATTGAGTATTATGATTTTTGCATTGAA
ATGATGATCATGGTCATGGGTAAGGGCCTTTTGGTATTGTATTGGATGATTTAGCTATGGATTGAAGTGGTGAAAATGGATTGGTGGTACGCTGCCCTAA
ATCTCTTGATATTATGTAAATTAGGTCTTGAATTATGTTGTGATTGGTATGGTCCACTTATGGTGGTGGTGCTTTGTGTTTACTTGTGAATTGTGTGGCC
TTGTCGGCATTACTTTATGTATTATTATGATAATGGCCTTGTCGGCATTACTTGGTATATTATGATGATTTGTGCAGTTGACTTATTTGAAGTATGCTCA
TATATATCTACATGTGATTAAGGTGAAACTATATGTTTCTTCTATTGGTATTAGACGATCATGTTAGACTAGCACTATGTCCTTAGGTGTGTAGTCTTAG
ATTGAGTGCATGATTCTTCCTAATTGGCTATG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.916935
Expected error %
0.36522
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057E10
Clone
Clone name
hba-57e10
LE_HBa0057E10
C12HBa0057E10
P057E10
Clone type
BAC
Contamination
none
Estimated length
115,948
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found