Clone Read LE_HBa0057E23_T7_45165

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057E23_T7_45165
Primer
T7
ID from Seq. Facility
LE_HBa_057_E23-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
685 trimmed for vector and quality, 822 raw
Sequence
>LE_HBa0057E23_T7_45165 (raw untrimmed)
CTGCGTACCCGGGGNTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTATGGCAATAGGTATGAATGAGTGTGACTTTGTTCTGAGAGCGAGTGTTGAAA
TGTAATCCTTATACTCAAACTGAAATCATTGTGTGAAAAATGAGGATTTTGTTCTAAAGTGAGGACACTAGTTGCAATACCGGAATTATGTGAGAAATTG
AAGAGGATAGGTGTTAGTGCATGGTGAGTCTGTGTCATGTTCGAATCCCACAAAAGTCAAGCCTAATAGTGATAGCATGCATAGATTTGATGGGATTAGT
CGGGATTGATAGCCAAATGATTGCAAAGGATAAAACATGAATACTATTGTACAAAGATTGTGTAGTGAGTCATAGTGCGTCGCTTGAGGACAAACAACGA
ATTTAAGTTGAGGGTGTTGATATACCGTGGTTTCACGGTATAATTAATACCTTTTCCTTAAGTTTATTGTGTCCGAAAGCCTTTTTGTGCTAATTTTGAT
ATAAGTTTTTCTTTGTTTTGCAGGAAATCTGTCTAAAGCTGAATGCGGAGATTTTGAGCGAAAAATGAAGAAGAAACCACCTACGGAGCTTATGACGGTC
CGTCGTGCTTGTGACGGTCCGTAGGTGGCAGCGTATAGAAGCTGCTGAAGGAAGATGGGGAAGTCTGACCAAGTGTGGGATTACGAAGCTTGTGACGGTC
CGTCATGGATATGACGTCCTGCCGGTTCGTCGCGAAAATTCGAAAAGTGATCCCAATACCCAAATTCCAAGACGTTGAAGTATTTGGGTAACAAAGACCC
CTCTACGGAACCTGTCCCGCCT
>LE_HBa0057E23_T7_45165 (trimmed for quality and cloning vector)
AGCTTATGGCAATAGGTATGAATGAGTGTGACTTTGTTCTGAGAGCGAGTGTTGAAATGTAATCCTTATACTCAAACTGAAATCATTGTGTGAAAAATGA
GGATTTTGTTCTAAAGTGAGGACACTAGTTGCAATACCGGAATTATGTGAGAAATTGAAGAGGATAGGTGTTAGTGCATGGTGAGTCTGTGTCATGTTCG
AATCCCACAAAAGTCAAGCCTAATAGTGATAGCATGCATAGATTTGATGGGATTAGTCGGGATTGATAGCCAAATGATTGCAAAGGATAAAACATGAATA
CTATTGTACAAAGATTGTGTAGTGAGTCATAGTGCGTCGCTTGAGGACAAACAACGAATTTAAGTTGAGGGTGTTGATATACCGTGGTTTCACGGTATAA
TTAATACCTTTTCCTTAAGTTTATTGTGTCCGAAAGCCTTTTTGTGCTAATTTTGATATAAGTTTTTCTTTGTTTTGCAGGAAATCTGTCTAAAGCTGAA
TGCGGAGATTTTGAGCGAAAAATGAAGAAGAAACCACCTACGGAGCTTATGACGGTCCGTCGTGCTTGTGACGGTCCGTAGGTGGCAGCGTATAGAAGCT
GCTGAAGGAAGATGGGGAAGTCTGACCAAGTGTGGGATTACGAAGCTTGTGACGGTCCGTCATGGATATGACGTCCTGCCGGTTC

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.95408
Expected error %
0.788108
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057E23
Clone
Clone name
hba-57e23
LE_HBa0057E23
C07HBa0057E23
P057E23
Clone type
BAC
Contamination
none
Estimated length
93,523
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found