Clone Read LE_HBa0057K03_T7_45413

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057K03_T7_45413
Primer
T7
ID from Seq. Facility
LE_HBa_057_K03-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
707 trimmed for vector and quality, 846 raw
Sequence
>LE_HBa0057K03_T7_45413 (raw untrimmed)
TCGGTTCCCGGGGGAACCTCTAGAGTCGACCTGCAGGCATGCAAGCTTTTCCTGACTAATTTTGTTTCTTTATAACTATTTGTTTCACTATTTTCTGTTC
TTCAGCCTGAAATTTCACATATTTTGTTTTCTTTGTGAACATTTTAACAACCCTGTATTCATCATTTGACTTGTTTCTTTAGGCTTCTCGATGATACTCC
CACTCTTTTCAGCTACTGGTCTCTTATCCAGGCTGACTTCCATTTTCCTTGGCGTTGCACCTCCCTTCCTGCTTCTATCAATCGGGTATCTCCATCATTT
TGTTGCTTAGGCTAGGAGTAAATTCAATTTTATAACTTTATGAGTCAGAATCTATAAGCTTTTGAATCTCCTGCAGTTATGAAGCAGTCTTCTATGGTGC
TCTCAGTCTTGCACTTATAGCATGGATACTGGCGGAAAATGCTTATCTCCATATAAGCAAGTTCAGATCATCAGCTCCAGTCAAATCCATGGAGGATGAT
AATAGGTGTCTGGAGTTATCCGATATGAGGATCCCATTAACTTTTGTAAGTTTTACGTTCTGTTTAGCTTAATGATGTTCTACTTATGGAAAAAAGAAAG
ACAGTGACATTGTCTTTAGCCTTGTTAATTTAACACTTTTGGGGTGTAAGCATCTAGCTCTGTTGTCTTTCTATATATCCAAATAGTGAAGTGTCTTAAA
TTGCTGATGAAATTTCTTCTTTTTAGATGGTCTTTTTCAATATTGGCATTCTTTTGGAACTGGGAAATTTGGCAAGTATTGCAAGTTTTTGAGATCTCCC
TCCGTGGTATCCAATTCCTTTAAAATTTTCAAGTGTAAAGTGGAAA
>LE_HBa0057K03_T7_45413 (trimmed for quality and cloning vector)
AGCTTTTCCTGACTAATTTTGTTTCTTTATAACTATTTGTTTCACTATTTTCTGTTCTTCAGCCTGAAATTTCACATATTTTGTTTTCTTTGTGAACATT
TTAACAACCCTGTATTCATCATTTGACTTGTTTCTTTAGGCTTCTCGATGATACTCCCACTCTTTTCAGCTACTGGTCTCTTATCCAGGCTGACTTCCAT
TTTCCTTGGCGTTGCACCTCCCTTCCTGCTTCTATCAATCGGGTATCTCCATCATTTTGTTGCTTAGGCTAGGAGTAAATTCAATTTTATAACTTTATGA
GTCAGAATCTATAAGCTTTTGAATCTCCTGCAGTTATGAAGCAGTCTTCTATGGTGCTCTCAGTCTTGCACTTATAGCATGGATACTGGCGGAAAATGCT
TATCTCCATATAAGCAAGTTCAGATCATCAGCTCCAGTCAAATCCATGGAGGATGATAATAGGTGTCTGGAGTTATCCGATATGAGGATCCCATTAACTT
TTGTAAGTTTTACGTTCTGTTTAGCTTAATGATGTTCTACTTATGGAAAAAAGAAAGACAGTGACATTGTCTTTAGCCTTGTTAATTTAACACTTTTGGG
GTGTAAGCATCTAGCTCTGTTGTCTTTCTATATATCCAAATAGTGAAGTGTCTTAAATTGCTGATGAAATTTCTTCTTTTTAGATGGTCTTTTTCAATAT
TGGCATT

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.936256
Expected error %
0.144307
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057K03
Clone
Clone name
hba-57k3
LE_HBa0057K03
P057K03
Clone type
BAC
Contamination
none
Estimated length
not yet estimated
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found