Clone Read LE_HBa0057K22_SP6_45450

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057K22_SP6_45450
Primer
SP6
ID from Seq. Facility
LE_HBa_057_K22-SP6
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
719 trimmed for vector and quality, 830 raw
Sequence
>LE_HBa0057K22_SP6_45450 (raw untrimmed)
CTAGCGCAGCAATNACATGTGATGAGAAGCTGCTCCTAGGCCTTTTGTTAGTATGTCTGCTGGTTGTTGTTTGGTGTTCACATAAGTAGGCAGTATCAGT
CCACTTCTTATTTTTCACTTCCAAAATGAAGATCAACTTTTATGTGCTTGAACCTTTCATGGAAGATAGGATTAGTAGCTAGTTGCATTGTTGCCTTCCT
GTCAAAGTGCAACCTGATAGGAATTCTGACAATAACATTAAGTTCCTGTAACAGACTAACCATTCGAATTATCTCTGAAACTACACTGACCATGCTCCTA
TACTCAGCCTCTGCAGAGCTTCTGCTGATTGTGTGTGCTTTTTGGACTTCCAATATATGAGAGAATCTCCTAATTTATATTAAAGAAGGTATTACATAAG
AGAATATAGGGTCATTGTGTAAATATTAAAAATTAAAGGATTAGATATCAAGAAGGTAGTTAGAGTAGTAATAACCATATACTTCACTTCTGTGTATATA
TATATATATACATATGTACATAACTTATGAGTATCAATGTAAGCAGTTCATAAATTTGTTAATTCCTCTCTTCCTCCCTTCCTCTCTTCTTCTCTTCTTC
TCTTCTTCTCTTCTTCTCTGCATCTATACTTGCCATTTACATCCAGCTGTATGTTGGGCCCAAGCCTTTTAGGACGTAGCTTAGCACTATATATAGACGC
TATGTCAAACCCTATTCTGTAATTCTGTTTTTGCCTCTCCATAATAAAACTGCTCCCTCTCTTCCCGTGGACGTAGCCAATTTATTGGTGAAACCACGTA
AATTCTGTTGTCTTGTTTTTTTTGCGTTTA
>LE_HBa0057K22_SP6_45450 (trimmed for quality and cloning vector)
TGTGATGAGAAGCTGCTCCTAGGCCTTTTGTTAGTATGTCTGCTGGTTGTTGTTTGGTGTTCACATAAGTAGGCAGTATCAGTCCACTTCTTATTTTTCA
CTTCCAAAATGAAGATCAACTTTTATGTGCTTGAACCTTTCATGGAAGATAGGATTAGTAGCTAGTTGCATTGTTGCCTTCCTGTCAAAGTGCAACCTGA
TAGGAATTCTGACAATAACATTAAGTTCCTGTAACAGACTAACCATTCGAATTATCTCTGAAACTACACTGACCATGCTCCTATACTCAGCCTCTGCAGA
GCTTCTGCTGATTGTGTGTGCTTTTTGGACTTCCAATATATGAGAGAATCTCCTAATTTATATTAAAGAAGGTATTACATAAGAGAATATAGGGTCATTG
TGTAAATATTAAAAATTAAAGGATTAGATATCAAGAAGGTAGTTAGAGTAGTAATAACCATATACTTCACTTCTGTGTATATATATATATATACATATGT
ACATAACTTATGAGTATCAATGTAAGCAGTTCATAAATTTGTTAATTCCTCTCTTCCTCCCTTCCTCTCTTCTTCTCTTCTTCTCTTCTTCTCTTCTTCT
CTGCATCTATACTTGCCATTTACATCCAGCTGTATGTTGGGCCCAAGCCTTTTAGGACGTAGCTTAGCACTATATATAGACGCTATGTCAAACCCTATTC
TGTAATTCTGTTTTTGCCT

Warnings:
  • Not screened for chimera
  • Not screened for repetitive elements
Quality Report
Processed by
SGN
Vector signature
flanking vector not found in read
Quality trim threshold
20.5
Sequence entropy
0.947019
Expected error %
0.105196
Sequence Annotations 
Automatic Annotations
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAU89728.1| Score 89 E Value 5e-23 Identity 52.60% Align. Length 322bp (44.78%) Frame 3
putative retroelement pol polyprotein-like [Solanum tuberosum]
NCBI NR non-redundant protein sequence database (genbank/nr)NCBI BLAST
gb|AAC33963.1| Score 77 E Value 1e-15 Identity 47.90% Align. Length 354bp (49.24%) Frame 3
contains similarity to reverse transcriptases (Pfam; rvt.hmm, score: 11.19) [Arabidopsis thaliana] pir||T01879 hypothetical protein F8M12.17 - Arabidopsis thaliana
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057K22
Clone
Clone name
hba-57k22
LE_HBa0057K22
P057K22
Clone type
BAC
Contamination
none
Estimated length
103,549
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found