Clone Read LE_HBa0057K22_T7_45451

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057K22_T7_45451
Primer
T7
ID from Seq. Facility
LE_HBa_057_K22-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
746 trimmed for vector and quality, 842 raw
Sequence
>LE_HBa0057K22_T7_45451 (raw untrimmed)
CCGGGTCCCGGGGGTTCCTCTAGAGTCGACCTGCAGGCATGCAAGCTNTTGTTTGAGTTCTTCCACAACATGGCGCGGGGTAGTTTCCAAAAATCATTGT
AAGGGGGAGTGTAAAAAATGATACAGTTAATCTTTGGAATATCATAGATTTTTCTAATATAGTTTCTAGAATGGTCTAGTGTAGGACTTGGAATAATTAT
CCTGAAGATATATCTATATATTCTAGAGAAAGTGCTAGAAGATAAGTTCACTAGAACTTTCTTGAAGATTTTTTTTGTAGTAAATGATATAATAGTCTAG
AACTTGTAGTATCTAGAACAATCTATTGGCTAGAATAAATATGGGATGATATTGTACATTTGTAATCAACCCAAGTAAACCAAGAACAACCTAATAAAAG
AGTATTCTTCCATAAATAAGTTCTCATTTCTAGTTTTCCCTTCATTAGTTGAATCTTCCGATCTTAGTTAACGATCATGGTGTAGCAGAAGGTTTCCTAG
TTACATTTTTCTTCTATCCTCTACAGGATTAGTTACAGAAATTTGATCCCCAAATCTCACATTTATTTTATAATACAGAGACCCGTGTCCCTTTAAGGAC
ATCCAATATATTTTAACGATTCAGGATATACTAGGACACTGCTTATATTCAAAAAATTGAATGAAAACACAAAGGCAGCGAGCAATATCATTAGATACAC
AATCAACTTAACAGAAAAGTGTATGGGAAAAGCAGTTAACCATTTATCGAACTGCTAGAAATTAATATTATTCATTAAAACATCAGCAGAGAATATTAGT
AAGTCTACTACTATGCAGAAGTGAGAAAGTTACTGTACAAGA
>LE_HBa0057K22_T7_45451 (trimmed for quality and cloning vector)
AGCTNTTGTTTGAGTTCTTCCACAACATGGCGCGGGGTAGTTTCCAAAAATCATTGTAAGGGGGAGTGTAAAAAATGATACAGTTAATCTTTGGAATATC
ATAGATTTTTCTAATATAGTTTCTAGAATGGTCTAGTGTAGGACTTGGAATAATTATCCTGAAGATATATCTATATATTCTAGAGAAAGTGCTAGAAGAT
AAGTTCACTAGAACTTTCTTGAAGATTTTTTTTGTAGTAAATGATATAATAGTCTAGAACTTGTAGTATCTAGAACAATCTATTGGCTAGAATAAATATG
GGATGATATTGTACATTTGTAATCAACCCAAGTAAACCAAGAACAACCTAATAAAAGAGTATTCTTCCATAAATAAGTTCTCATTTCTAGTTTTCCCTTC
ATTAGTTGAATCTTCCGATCTTAGTTAACGATCATGGTGTAGCAGAAGGTTTCCTAGTTACATTTTTCTTCTATCCTCTACAGGATTAGTTACAGAAATT
TGATCCCCAAATCTCACATTTATTTTATAATACAGAGACCCGTGTCCCTTTAAGGACATCCAATATATTTTAACGATTCAGGATATACTAGGACACTGCT
TATATTCAAAAAATTGAATGAAAACACAAAGGCAGCGAGCAATATCATTAGATACACAATCAACTTAACAGAAAAGTGTATGGGAAAAGCAGTTAACCAT
TTATCGAACTGCTAGAAATTAATATTATTCATTAAAACATCAGCAG

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.947809
Expected error %
0.523044
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057K22
Clone
Clone name
hba-57k22
LE_HBa0057K22
P057K22
Clone type
BAC
Contamination
none
Estimated length
103,549
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found