Clone Read LE_HBa0057M14_T7_45531

Sequence Read 
Read Class
BAC ends
Read ID
LE_HBa0057M14_T7_45531
Primer
T7
ID from Seq. Facility
LE_HBa_057_M14-T7
Chromatogram
Sequence 
Version
1 (current)
Length (bp)
704 trimmed for vector and quality, 884 raw
Sequence
>LE_HBa0057M14_T7_45531 (raw untrimmed)
GGGTCCCGGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTAAACTCCTAAACAAACCGTTTCCATTTTCTTGTTTGCATCAATTGGTACCTGTT
CAGTAAATGTAAACACTCTTTTTCCTACATGTCATCTATATAATATAGCAAGTTGTTGCAGGAACACAACTAATTTACATAAAATGGATAAGGATAGCAG
CTTAGCATAGATTGGACTAAAGTGGAGGAGAATGGACTGTTGCCTTCCAATCTTTATGAAGAATATTCACACAATCTATGAAAAACTGCTCGAGCCAATT
CCCAAAACGGCCATGAATGGAGAATAGAGATTCTTTCGAGAGAGAGGAGAATGTCGTAAAAGATTATTATATAGATATTGCTATTGTCATTAAAATTATG
TATCCATTTGCAATACAAATACAACAATGACCACACAATCTCCTTCACTTCCAGTTCCCCGGCATAAAAAGACTGCCAACCTTAGGAAACAAAAATACTT
TACAGCTACATAGTGAAAGGATCATTTGAATACCTTATCACATTAGCAGTCTGCATATGCAAAGGAAAAAGAGCAAAGTACATGATATAAACCACTGATC
GATGGACATATATGCCCGGAATTGAAATCAATGGTCATACAGTTGGAACACTTTCAGATCTGTACAGTCGGGTTTCAACTTGTGGTCATTCGCTATTGTT
TCTTTCATCAGGGAATTTAATGCAAGTAAAGCAGCTCCTACCGCAGGCTCCACCCTGAAGAATTGGGTGGACAGAAACATTAAACAATAGGAAAAAATTT
AAGAAAAGAAAACAGTTTCCCCTGGAAAAAAAAAATGAAAGCTAATTTTAAAAAAAAAAATGGGGTAAAAAGTAAAAAAAAAAA
>LE_HBa0057M14_T7_45531 (trimmed for quality and cloning vector)
AGCTTAAACTCCTAAACAAACCGTTTCCATTTTCTTGTTTGCATCAATTGGTACCTGTTCAGTAAATGTAAACACTCTTTTTCCTACATGTCATCTATAT
AATATAGCAAGTTGTTGCAGGAACACAACTAATTTACATAAAATGGATAAGGATAGCAGCTTAGCATAGATTGGACTAAAGTGGAGGAGAATGGACTGTT
GCCTTCCAATCTTTATGAAGAATATTCACACAATCTATGAAAAACTGCTCGAGCCAATTCCCAAAACGGCCATGAATGGAGAATAGAGATTCTTTCGAGA
GAGAGGAGAATGTCGTAAAAGATTATTATATAGATATTGCTATTGTCATTAAAATTATGTATCCATTTGCAATACAAATACAACAATGACCACACAATCT
CCTTCACTTCCAGTTCCCCGGCATAAAAAGACTGCCAACCTTAGGAAACAAAAATACTTTACAGCTACATAGTGAAAGGATCATTTGAATACCTTATCAC
ATTAGCAGTCTGCATATGCAAAGGAAAAAGAGCAAAGTACATGATATAAACCACTGATCGATGGACATATATGCCCGGAATTGAAATCAATGGTCATACA
GTTGGAACACTTTCAGATCTGTACAGTCGGGTTTCAACTTGTGGTCATTCGCTATTGTTTCTTTCATCAGGGAATTTAATGCAAGTAAAGCAGCTCCTAC
CGCA

Warnings:
  • Not screened for repetitive elements
  • Not screened for chimera
Quality Report
Processed by
SGN
Vector signature
5' read, flanking vector found
Quality trim threshold
12.5
Sequence entropy
0.963331
Expected error %
0.55442
Sequence Annotations 
Automatic Annotations
No automatic annotations found.
Manual Annotations
No manual annotations found.
BAC 
Clone LE_HBa0057M14
Clone
Clone name
hba-57m14
LE_HBa0057M14
P057M14
Clone type
BAC
Contamination
none
Estimated length
101,307
Library
Name
Tomato HindIII BAC Library
Cloning host
E. coli
Organism
Solanum lycopersicum (formerly Lycopersicon esculentum)
Cloning vector
Accession
Heinz 1706
Restriction enzyme
HindIII

Other Reads:
1 sequencing reads found